EXCLI J EXCLI Journal 1611-2156 Leibniz Research Centre for Working Environment and Human Factors 2016-847 10.17179/excli2016-847 Doc174 Review article Distribution of polymorphic variants of CYP2A6 and their involvement in nicotine addiction López-Flores Luis A. 1 Pérez-Rubio Gloria 1 Falfán-Valencia Ramcés * 1 Instituto Nacional de Enfermedades Respiratorias Ismael Cosio Villegas *To whom correspondence should be addressed: Ramcés Falfán-Valencia, Laboratorio HLA, Instituto Nacional de Enfermedades Respiratorias Ismael Cosio Villegas. Calzada de Tlalpan 4502. Sección XVI. Tlalpan, 14080 México City. México. Phone +52 55 5487 1700 ext. 5152, E-mail: rfalfanv@iner.gob.mx 06 03 2017 2017 16 174 196 19 12 2016 13 02 2017 Copyright © 2017 López-Flores et al. 2017

This is an Open Access article distributed under the terms of the Creative Commons Attribution Licence (http://creativecommons.org/licenses/by/4.0/) You are free to copy, distribute and transmit the work, provided the original author and source are credited.

This article is available from http://www.excli.de/vol16/Falfan-Valencia_06032017_proof.pdf

Tobacco consumption has become a major public health issue, which has motivated studies to identify and understand the biological processes involved in the smoking behavior for prevention and smoking cessation treatments. CYP2A6 has been identified as the main gene that codifies the enzyme that metabolizes nicotine. Many alleles have been identified after the discovery of CYP2A6, suggesting a wide interethnic variability and a diverse smoking behavior of the allele carrying individuals. The main purpose of this review is to update and highlight the effects of the CYP2A6 gene variability related to tobacco consumption reported from diverse human populations. The review further aims to consider CYP2A6 in future studies as a possible genetic marker for the prevention and treatment of nicotine addiction. Therefore, we analyzed several population studies and their importance at addressing and characterizing a population using specific parameters. Our efforts may contribute to a personalized system for detecting, preventing and treating populations at a higher risk of smoking to avoid diseases related to tobacco consumption.

CYP2A6 ethnic differences genetic polymorphism tobacco consumption nicotine metabolism nicotine addiction
Introduction

Tobacco consumption has become an epidemic affecting more than 1,000 million people worldwide and is considered the main cause of avoidable death causing approximately 6 million premature deaths each year (WHO, 2011[146]). Thus, tobacco consumption is a public health issue combined with economic losses; it has motivated studies for identifying and understanding the biological processes involved in the smoking behavior for prevention and smoking cessation treatments (Bierut et al, 2014[15]).

Among cigarette compounds, nicotine is responsible for causing dependence by stimulating the smoker and allowing the other compounds to access the body, causing chronic harmful effects and tobacco-related diseases.

Tobacco consumption is caused by environmental, psychosocial and genetic factors (Bierut, et al., 2014[15]). Previous studies have identified genes encoding proteins that influence nicotine addictive behavior due to their effect on the cerebral neurotransmission pathways (Al Koudsi and Tyndale, 2005[4]; Arinami et al., 2000[5]; Verde Rello and Santiago Dorrego, 2013[141]). Moreover, some gene products are involved in nicotine response as receptors and metabolizers (Hukkanen et al., 2005[55]; Verde Rello and Santiago Dorrego, 2013[141]). Pérez-Rubio et al. (2015[108]) have reviewed this subject in detail. In the metabolizers group, the CYP2A6 gene plays an important role. Its protein product (by the same name) is the principal enzyme responsible for nicotine metabolism to cotinine and other sub-products in the human body. However, more than 45 alleles have been discovered suggesting wide interindividual and interethnic variety.

The main purpose of this review is to update and highlight the effects of the genetic polymorphisms of CYP2A6 related to tobacco consumption reported in diverse human populations. Moreover, we aimed to consider these polymorphisms in future studies as possible genetic markers for the prevention and treatment of nicotine addiction.

Biological Function of CYP2A6 in Smoking

The CYP2A6 enzyme belongs to the enzyme superfamily known as the cytochrome P450 system (CYP450), also classified in the drug metabolizing enzymes group. These enzymes are found in the endoplasmic reticulum of the cells of some tissues in the body, particularly in the liver. Moreover, they are phase I enzymes responsible for metabolizing more than 80 % of drugs such as xenobiotics and endogen products in the body (Evans and Relling, 2004[33]; Ingelman-Sundberg, 2004[56]).

CYP2A6 is found mainly in the liver and is approximately 5-10 % of the total CYP450 content (Shimada et al., 1996[120]; Yamano et al., 1990[148]), although it has also been found to be expressed in the nasal mucosa, trachea, bronchi, lungs, sinuses and several brain regions (Bhagwat et al., 2000[14]; Chiang et al., 2012[22]; Crawford et al., 1998[24]; Ding and Kaminsky, 2003[29]; Macé et al., 1998[78]).

CYP2A6 has demonstrated to be involved in the metabolism of some endogen and exogen substrates such as precarcinogenic and carcinogenic compounds, as well as some toxins and drugs including nicotine.

CYP2A6 has been particularly important in tobacco consumption because of its involvement in nicotine metabolism. Nicotine is the main compound in tobacco responsible for the development of cigarette addiction by stimulating nicotinic cholinergic receptors (nAChR) that release neurotransmitters in the brain and cause a pleasant sensation in the smoker. The nicotine availability in the body is mediated by biological factors, mainly those related to its metabolism. Smokers tend to consume the same amount of nicotine each day to acquire the desired effects by modulating their smoking behavior to adjust nicotine availability for the purpose of regulating nicotine levels in the body (Benowitz, 1992[10]).

It has been reported that CYP2A6 is the main enzyme involved in the nicotine oxidation to cotinine. CYP2A6 catalyzes approximately 80 % (55-92 %) of this reaction via C-oxidation in addition to other metabolic pathways for nicotine and its metabolites (Benowitz and Jacob III, 1994[11]; Messina et al., 1997[83]; Nakajima et al., 1996[94]). Some other enzymes of CYP450 contribute to a lesser degree to nicotine metabolism such as CYP2B6, CYP2A13, CYP2D6 and CYP2E1 (mentioned in the order of relevance).

These biological products interact directly with nicotine to affect physiological brain processes (e.g., nAChR) and are inactivated and removed from the body (e.g., CYP450 enzymes) making their genes ideal candidates for altering smoking behavior (Malaiyandi et al., 2005[82]).

CYP2A6 Genetic Variants

The CYP2A6 gene has a 6 kb extension length, and it is composed of 9 exons, which encode for a 494 amino-acid product (Fernandez-Salguero et al., 1995[34]). It is located in the chromosomal band 19q13.2, where other CYP450 gene subfamilies (CYP2B, CYP2F, CYP2G, CYP2S, and CYP2T) are also present. The CYP2A subfamily cluster includes the CYP2A6, CYP2A7, and CYP2A13 genes and other pseudogenes (Hoffman et al., 2001[52]).

The Human CYP-Allele Nomenclature Database (HCAND) (http://www.cypalleles.ki.se) was created in 1999 for the identification and characterization of CYP2A6 alleles (and other CYP450 genes). This database consists of a committee for unifying and assigning nomenclature for the already discovered alleles and alleles to be discovered in the future (Sim and Ingelman-Sundberg, 2010[121], 2013[122]).

To date, 42 well-characterized alleles and some haplotypes that are uncharacterized (“CYP2A6 allele nomenclature,” 2014[25]) have been identified. These alleles are determined according to the origins of their mutation(s), such as gene conversion, gene deletion, gene duplication and/or single nucleotide polymorphism (SNP). The gene mutations are summarized in Figure 1(Fig. 1).

The wild-type allele that is considered as a reference is CYP2A6*1A (Yamano et al., 1990[148]). CYP2A6*1B consists of a 58 bp gene conversion with CYP2A7 in the CYP2A6 3' UTR region (Ariyoshi et al., 2000[8]; Yamano et al., 1990[148]). In vitro and in vivo assays have shown that the CYP2A6 3' UTR region has more enzymatic activity and RNA stabilization than the reference allele (Ho et al., 2009[49]; Wang et al, 2006[143]; Yoshida et al., 2002[150]). However, several haplotypes contain this gene conversion and other noncoding genetic changes and have been designated CYP2A6*1B1-B17 (Ariyoshi et al., 2000[8]; Haberl et al., 2005[46]; Mwenifumbo et al., 2007[89], 2008[87], 2010[90]; Nakajima et al., 2006[91]; Pitarque et al., 2004[111]; Yamano et al., 1990[148]). Moreover, it has been determined that other wild-type alleles, named CYP2A6*1D-L, that have genetic changes in coding, noncoding and regulatory regions (Mwenifumbo et al., 2008[87], 2010[90]; Nakajima et al, 2004[95]; Pitarque et al., 2004[111]; von Richter et al., 2004[142]; Yamano et al., 1990[148]).

CYP2A6*2 consists of a missense mutation of 1799T>A, causing an amino acid change of Leu160His in the enzyme. Thus, the protein does not incorporate the heme group, inactivating the enzyme for in vitro and in vivo assays (Benowitz et al., 1995[12]; Hadidi et al., 1997[47]; Oscarson, et al., 1999[103]; Yamano et al., 1990[148]).

CYP2A6*3 is presumed to be a gene conversion of CYP2A6 to CYP2A7, which results in an inactive enzyme; however, the methodology for their detection, function, and allelic frequency has been controversial (Fernandez-Salguero et al., 1995[34]; Oscarson et al., 1998[100]; Yamano et al., 1990[148]).

CYP2A6*4 consists of a homologous unequal crossover with CYP2A7 on several positions (CYP2A6*4A-F), which leads to a whole gene deletion causing loss of enzymatic activity (Kitagawa et al., 1999[62]; Nakajima et al., 2000[93], 2001[92]; Nunoya et al., 1999[97]).

CYP2A6*5 contains a missense mutation, 6582G>T, creating a Gly479Val amino acid change and resulting in a lack of enzyme function (Oscarson et al., 1999[103]).

CYP2A6*6 contains a missense mutation, 6582G>T, which creates an Arg128Gln amino acid change causing lower enzymatic activity of the enzyme (Kitagawa et al., 2001[63]).

CYP2A6*7 contains a missense mutation, 6558G>A, which produces an Ile471Thr amino acid change that decreases the enzymatic activity to metabolize some substrates for in vivo and in vitro assays (Ariyoshi et al, 2001[7]; Uno et al., 2013[138]; Xu et al., 2002[147]).

CYP2A6*8 contains a missense mutation, 6600G>T, creating an amino acid change in Arg485Leu; however, the mutation's effect apparently does not change the enzymatic activity (Xu et al., 2002[147]).

CYP2A6*9 contains a point mutation, -48T>G, on the TATA box located in the gene promoter, which results in a decrease of more than 50 % of the enzymatic activity for in vitro and in vivo assays (Pitarque et al., 2001[110]; Yoshida et al., 2003[149]). There have been identified two subtypes of this allele: CYP2A6*9A, which contains an additional -1013A>G point mutation (von Richter et al., 2004[142]), and CYP2A6*9B, which contains the point mutations -1680A>G, -1301A>C, -1289G>A, 1620T>C, 1836G>T, 6354T>C and 6692C>G (Haberl et al., 2005[46]).

CYP2A6*10 contains two point mutations, similar to the CYP2A6*7 and CYP2A6*8 alleles. These point mutations decrease the enzymatic activity dramatically and make it completely inactive for some substrates (Xu et al., 2002[147]).

CYP2A6*11 contains a missense mutation, 3391T>C, which results in the amino acid change of Ser224Pro, decreasing the enzymatic activity (Daigo et al., 2002[26]).

CYP2A6*12A originated by the unequal crossover between CYP2A6 and CYP2A7, which resulted in a hybrid allele at the 5' UTR and exons 1- 2 belonging to CYP2A7 and from the 3rd to 9th exon belonging to CYP2A6. This generates a 10 amino acid substitution compared to the reference allele (Oscarson et al., 2002[101]). Later, several SNPs were discovered in the same allele, which generates two subvariants (CYP2A6*12B-C) (Haberl et al., 2005[46]). These alleles are classified as null enzymatic activity (Bloom et al., 2011[17]).

CYP2A6*13 has two point mutations: the first at -48T>G in the TATA box of the promoter and the second at 13G>A changes the amino acid Gly5Arg. The enzymatic activity is decreased (Kiyotani et al., 2002[64]; Nakajima et al., 2006[91]).

CYP2A6*14 has the missense mutation 86G>A and changes the Ser29Asn amino acid chain; however, this does not affect the enzymatic activity (Kiyotani et al., 2002[64]; Nakajima et al., 2006[91]).

CYP2A6*15 is the product of two point mutations: the first at -48T>G in the TATA box of the promoter and the second at 2134 A>G, which results in an amino acid change of Lys194Glu (Kiyotani et al., 2002[64]). However, this enzyme does not show differences in substrate metabolism (Tiong et al., 2014[134]; 2010[135]).

CYP2A6*16 has a missense mutation at 2161C>A, which makes an amino acid change of Arg203Ser (Kiyotani et al., 2002[64]); however, it does not cause a defect in the enzymatic activity (Ho et al., 2008[50]; Nakajima et al., 2006[91]; Tiong et al., 2014[134], 2010[135]).

CYP2A6*17 shows several point mutations, 51G>A, 209C>T, 1779G>A, 4489C>T, 5065G>A, 5163G>A, 5717C>T and 5825A>G, which result in the amino acid change Val365Met and cause a decrease in the enzymatic activity of the allele (Fukami et al., 2004[41]).

CYP2A6*18 has three subvariants that share the missense mutation at 5886A>T and the amino-acid change Tyr392Phe. CYP2A6*18A only has that point mutation while CYP2A6*18B also has synonymous substitutions at 51G>A, 5684T>C and 5702T>C. CYP2A6*18C also has the point mutations at -1680A>G, -1579T>C, -1464A>T, -1301A>C, -1289G>A, -1013A>G, 1620T>C, 5668A>T and 6692C>G. The enzymatic activity of this allele tends to be specific according to the substrate (Fukami et al., 2005[38]; Haberl et al., 2005[46]).

CYP2A6*19 is produced by the point mutations at 5668A>T, 6354T>C, and 6558T>C and a gene conversion at the 3'UTR with CYP2A7, which correspond to the amino acid changes of Tyr392Phe and Ile471Thr, decreasing the enzymatic activity (Fukami et al., 2005[38]).

CYP2A6*20 has a frameshift mutation at nucleotides 2140 and 2141, which displaces the frameshift from the codon 196 to stop prematurely at 220 codons. In addition, it has three point mutations at 51G>A, 5684T>C and 6692C>G. These mutations produce a loss-of-function enzyme (Fukami et al., 2005[37]; Mwenifumbo et al., 2008[87]).

CYP2A6*21 is the result of two point mutations: 51G>A and 6573A>G, which produce an amino acid change Lys476Arg (Haberl et al., 2005[46]). However, the functional effect of the enzyme is still under discussion because it has been reported that in vivo assays show differences according to the study population (Al Koudsi et al., 2006[3]; Mwenifumbo et al., 2008[87]) and in vitro assays show normal enzymatic activity (Tiong et al., 2014[134], 2010[135]).

CYP2A6*22 is the result of three point mutations: 51G>A, 1794C>G and 1798C>A, which cause the amino acid changes Asp158Glu and Leu160Ile (Haberl et al., 2005[46]). These mutations reduce the enzyme affinity to the substrates; CYP2A6*22 has 39 % of the enzyme activity compared to the reference allele (Tiong et al., 2014[134], 2010[135]).

CYP2A6*23 contains a point mutation at 2161C>T that corresponds to the amino acid change Arg203Cys; this decreases the enzymatic activity to 19 % compared to the reference allele (Ho et al., 2009[49], 2008[50]).

CYP2A6*24 has two subvariants, among which CYP2A6*24A has the following point mutations: -1301A>C, -1289G>A, -1013A>G, 51G, 578A>G, 594G>C, 720G>A, 1137C>G, 1620T>C, 2483G>A, 3225A>G, 5668A, 6218A>G, 6282A>G, 6293T>C, 6354T>C, 6458A>T, , 6782C>G and 7160A>G, as well as a gene conversion in the 3'UTR of 58 bp. However, CYP2A6*24B has a 1381_1382CT>TC substitution and 1481_1486delCTCTCT deletion. These mutations cause the amino acid changes Val110Leu and Asn438Tyr, which encode a loss-of-function enzyme (Mwenifumbo et al., 2008[87]).

CYP2A6*25 is the result of several point mutations, some of them in 5'UTR: -1301A>C, -1289G>A and -745A>G, also 22C>T, 51G, 768A>T, 1620T>C, 1672T>C, 2296C>T, 2483G>A, 2605G>A, 2921G>A, 2994T>C, 4636A>C, 5668A, 6586T>C, 6692C>G and 7160A>G that result in the amino acid change of Phe118Leu (Mwenifumbo et al., 2008[87]), it has been shown that its enzymatic activity is decreased in some substrates (Ho et al., 2009[49]; Mwenifumbo et al., 2008[87]; Uno et al., 2013[138]).

CYP2A6*26 is produced by the following point mutations: -1301A>C, -1289G>A, -745A>G, 22C>T, 51G, 1165G>A, 1620T>C, 1672T>C, 1703G>T, 1710C>T, 1711T>G, 2296C>T, 2483G>A, 2994T>C, 4071delA, 4636A>C, 5668A, 6115C>T, 6586T>C, 6692C>G and 7160A>G which make amino acid changes in Phe118Leu, Arg128Leu and Ser131Ala (Mwenifumbo et al., 2008[87]). The in vivo and in vitro assays have proven that the final product is a loss-of-function enzyme (Ho et al., 2009[49]; Mwenifumbo et al., 2008[87]).

CYP2A6*27 has the following point mutations: -1301A>C, -1289G>A, -745A>G, 22C>T, 51G, 1620T>C, 1672T>C, 2162_2163GC>A, 2296C>T, 2483G>A, 2994T>C, 3872G>A, 4071delA, 4636A>C, 5668A, 5857T>A, 6586T>C, 6692C>G and 7160A>G, which makes the amino acid change Phe118Leu and also have a frameshift mutation, which displaces the frameshift to stop prematurely at 5th exon (Mwenifumbo et al., 2008[87]), resulting in a loss-of-function enzyme (Ho et al., 2009[49]; Mwenifumbo et al., 2008[87]).

CYP2A6*28 has two subvariants that share the following mutations: -1269T>C, 51G>A, 656G>T, 1620T>C, 4681T>G, 5668A, 5738C>T, 5745A>G, 5750G>C, 6354T>C, 6361C>A and 7160A>G, as well as a gene conversion in the 3'UTR of 58 bp. However, CYP2A6*28A also carries the point mutations 6385G>T, 6389C>G, 6390T>C and 6782C>G, on the other hand CYP2A6*28B has additionally the following mutations: 1381_1382CT>TC, 6960_6961ins GAAAAG and 1481_1486delCTCTCT. These mutations cause the amino acid change of Asn418Asp and Glu419Asp, however, the enzymatic activity is the same as the reference allele (Mwenifumbo et al., 2008[87]).

According to the HCAND, CYP2A6*29, 30, 32 and 33 alleles are now in evaluation phase (“CYP2A6 allele nomenclature,” 2014[25]).

CYP2A6*31 has two subvariants which share the following mutations: -1289G>A, -1013A>G, -492_-470delCCCCTTCCTGAGACCCTTAACCCinsAATCCATATGTGGA ATCTG, 16A>C, 51G, 1339C>G, 1620T>C, 2721G>A, 2994T>C, 3255A>G, 3315C>T, 5668A, 6692C>G and 7160A>G. However, CYP2A6*31A also has the point mutation of 7568C>T and CYP2A6*31B the mutations in -975T>C, 467C>T and 4074delA that cause the amino acid change Met6Leu (Mwenifumbo et al., 2008[87]), but the enzymatic activity has not been evaluated.

CYP2A6*34 originated by the unequal crossover between CYP2A6 and CYP2A7, which resulted in a hybrid allele at the 5'UTR and exons 1- 4 belonging to CYP2A7 and from the 5th to 9th exon belonging to CYP2A6 (di Iulio et al., 2009[28]). The enzymatic activity has not yet been evaluated, however could be similar to CYP2A6*12 and it might be a loss-of-function allele.

CYP2A6*35 has two subvariants that share the following mutations: -1301A>C, -1289G>A, 1620T>C, 6458A>T, 6782C>G, 7160A>G and a gene conversion at the 3'UTR with CYP2A7. However, CYP2A6*35A also has the following point mutations: -1013A>G, 720G>A, 1137C>G, 2483G>A, 3225A>G, 6218A>G, 6282A>G, 6293T>C and 6354T>C; on the other hand, CYP2A6*35B has the following point mutations: -745A>G, 22C>T, 4084delA, 6835C>A and 6999T>C (Al Koudsi et al., 2010[2]). These mutations produce a protein that has the amino acid change Asn438Tyr which decrease the enzymatic activity according to in vitro and in vivo assays (Al Koudsi et al., 2010[2]).

CYP2A6*36 has the following point mutations: -1301A>C, -1289G>A, -745A>G, 22C>T, 1620T>C, 4084delA, 6458A>T, 6558T>C, gene conversion at 3'UTR, 6782C>G, 6835C>A, 6999T>C and 7160A>G that change the amino acid of Asn438Tyr and Ile471Thr (Al Koudsi et al., 2010[2]). To date there are no assays that prove their enzymatic activity.

CYP2A6*37 is produced by the following mutations: -1301A>C, -1289G>A, -745A>G, 22C>T, 1620T>C, 4084delA, 6354T>C, 6458A>T, 6558T>C, 6600G>T, 6782C>G, 6835C>A, 6936_6937insCACTT, 6961_6962insGAAAAG, 6989A>G, 6999T>C, 7160A>G and a gene conversion at the 3'UTR, which make the amino acid changes Asn438Tyr, Ile471Thr and Arg485Leu (Al Koudsi et al., 2010[2]). There are no assays that prove the enzymatic activity.

CYP2A6*38 is a result of the missense mutation 5023A>G, which produces the amino acid change of Tyr351His (Bloom et al., 2011[17]). An in silico assay classified the SNP as harmful, suggesting a decreased enzymatic activity (Bloom et al., 2011[17]).

CYP2A6*39 was described by Pilinguian et al. (2014[109]) as a missense mutation of 468G>A; however, the HCAND (“CYP2A6 allele nomenclature,” 2014[25]) adds the point mutations 171C>A, 1779G>A and 5717C>T, which cause the amino acid change Val68Met. The enzymatic activity of this allele is reported as decreased to half of the reference allele (Piliguian et al., 2014[109]).

CYP2A6*40 has the missense mutation 1767C>G (Piliguian et al., 2014[109]), but later the HCAND (“CYP2A6 allele nomenclature,” 2014[25]) added the point mutations 144G>A, 3492C>T and 5738C>T, which modifies the amino acid to Ile149Met. The enzymatic activity is reported to be half of the reference allele (Piliguian et al., 2014[109]).

CYP2A6*41 contains the missense mutation 3515G>A according to Pilinguian et al. (2014[109]), but the HCAND (“CYP2A6 allele nomenclature,” 2014[25]) added the point mutations 51G>A and 507C>T, which changed the amino acid to Arg265Gln. This allele was shown to have a minimal alteration in expression and a normal enzymatic activity (Piliguian et al., 2014[109]).

CYP2A6*42 is the result of a missense mutation 3524T>C according to Pilinguian et al. (2014[109]), but the HCAND (“CYP2A6 allele nomenclature,” 2014[25]) added the mutations 51G>A and 5684T>C, which made the amino acid change Ile268Thr that decreases the expression and enzymatic activity on in vivo and in vitro assays (Piliguian et al., 2014[109]).

CYP2A6*43 has the missense mutation 4406C>T, which makes the amino acid change to Thr303Ile and shows decreased expression and enzymatic activity in in vivo and in vitro assays (Piliguian et al., 2014[109]).

CYP2A6*44 carries the missense mutation 5661G>A according to Pilinguian et al. (2014[109]), but later the HCAND (“CYP2A6 allele nomenclature,” 2014[25]) added the mutations 51G>A, 5738C>T, 5745A>G and 5750G>C, which modify the amino acids to Glu390Lys, Asn418Asp and Glu419Asp. These mutations have been shown to reduce the enzymatic activity and the reference allele expression to one-third (Piliguian et al., 2014[109]).

CYP2A6*45 has a missense mutation at 6531T>C according to Pilinguian et al. (2014[109]), but later the HCAND (“CYP2A6 allele nomenclature,” 2014[25]) added the point mutations 51G>A and 4464G>A, which change the amino acid Leu462Pro. The mutations have been proven (as in CYP2A6*44) to reduce the enzymatic activity and the reference allele expression to one-third (Piliguian et al., 2014[109]).

There are two CYP2A6 gene duplications: CYP2A6*1X2A originated by an unequal crossover from the 8th to 9th exon with CYP2A6*4D as a reciprocal product (Rao et al., 2000[112]). CYP2A6*1X2B also originated by an unequal crossover of CYP2A7 from 5.2 to 5.6 kb downstream of the stop codon with CYP2A6*4B as the reciprocal product (Fukami et al., 2007[40]). Its enzyme activity has been shown to increase in in vivo assays (Rao et al., 2000[112]).

CYP2A6 has been suggested as a highly polymorphic gene because it is located in a small chromosomal region that contains several genes and some unequal crossover events, point mutations and genetic conversions between CYP2A6 and CYP2A7 (Hoffman et al., 1995[51]). These facts, plus evolutionary forces such as genetic drift and natural selection, may have resulted in this genetic variability, which spread among human populations (Ingelman-Sundberg, 2004[56], 2005[58]). This genetic variability, similar to other CYP450 genes, could explain the metabolic response to exogenous compounds such as nicotine and other drugs that ranges from 20-40 % (Ingelman-Sundberg, 2001[57]).

CYP2A6 genotypes can be classified according to their alleles and their enzymatic activity, which is referred to as the metabolism range of 3-hydroxycotinine/cotinine (Dempsey et al., 2004[27]), as mentioned below:

-Ultrarapid metabolizers. Individuals who have an enzymatic activity >100 % of normal; they contain more than two functional alleles (the CYP2A6*1X2 allele).

-Normal metabolizers. Individuals who have an enzymatic activity of 100 % (normal); they contain two functional alleles.

-Intermediate metabolizers. Individuals who have an enzymatic activity ≤75 % of normal may contain a functional and a defective allele or even two partially defective alleles.

-Slow metabolizers. Individuals who have an enzymatic activity ≤50 % of normal can contain a functional and a loss-of-function allele or even two loss-of-function alleles.

Effects of CYP2A6 Genetic Variants on Tobacco Consumption

The genetic variability of CYP2A6 directly influences the range of nicotine metabolism in the body, which can indirectly affect the reinforcing and aversive nicotine properties in the brain and can change the individual risk of nicotine dependence. To prove the effect of CYP2A6 variants on tobacco consumption, several studies were conducted that included family, twin and non-related subject designs. These studies associate an allele with the amount of metabolized nicotine or another variable related to tobacco consumption.

Smokers who carry some CYP2A6 alleles show a different smoking behavior compared to carrying the wild-type allele, suggesting that smokers regulate their smoking behavior to obtain the desired nicotine levels in their body (Malaiyandi et al., 2005[82]; Rao et al., 2000[112]; Schoedel et al., 2004[117]).

The importance of the null and decreased biological function alleles is explained in smokers (carrying these alleles) who exhibit less time smoking (Liu et al., 2011[74]; Malaiyandi et al., 2006[81]), fewer cigarettes smoked (Audrain-McGovern et al., 2007[9]; Fujieda et al., 2004[36]; Malaiyandi et al., 2005[82]; Minematsu et al., 2006[84]; O'Loughlin et al., 2004[99]; Pan et al., 2015[104]; Rao et al., 2000[112]; Schoedel et al., 2004[117]; Thorgeirsson et al., 2010[132]), fewer aspirations per cigarette (Strasser et al., 2011[125]), later smoking onset (Gu et al., 2000[43]; O'Loughlin et al., 2004[99]; Schoedel et al., 2004[117]) and less nicotine dependence (Wassenaar et al., 2011[144]). Likewise, it has been reported that these individuals respond better to replacement nicotine therapy (Lerman et al., 2010[72]; Malaiyandi et al., 2006[81]). Moreover, they tolerate withdrawal symptoms (Kubota et al., 2006[68]) better and have higher rates of quitting smoking spontaneously (Chenoweth et al., 2013[21]; Malaiyandi et al., 2006[81]; Minematsu et al., 2003[85]; Ray et al., 2009[113]). These alleles have also been associated with lung, bladder, nasopharyngeal, esophageal and oral cancer (Fujieda et al., 2004[36]; Hosono et al., 2015[53]; Islam et al., 2013[59]; Ito et al., 2015[60]; Kumondai et al., 2016[69]; Lourembam et al., 2015[77]; Miyamoto et al., 1999[86]; Song et al., 2009[123]; Tamaki et al., 2011[130]; Tan et al., 2001[131]; Tiwawech et al., 2006[136]; Topcu et al., 2002[137]; Wassenaar et al., 2015[145]).

On the other hand, some reports do not prove the association between null and decreased CYP2A6 alleles related to tobacco consumption (London et al., 1999[75]; Loriot et al., 2001[76]; Sabol and Hamer, 1999[116]; Schulz et al., 2001[118]; Tiihonen et al., 2000[133]; Zhang et al., 2001[153]). This lack of association may occur because of several factors such as designing the population stratification (comparing populations where there are substructures between cases and controls) and population ethnicity, lack of detailed phenotypic evaluation, indeterminate comorbidities, different genotyping methods, examination of different allelic variants, inconsistency in smoking history and differences in symptoms of nicotine dependence among smokers (Lerman and Niaura, 2002[73]; O'Loughlin et al., 2004[99]).

Detecting the alleles of CYP2A6 can allow us to characterize different smoking behaviors and smoking-related diseases among individuals (Fujieda et al., 2004[36]), due to their role in nicotine metabolism and the metabolism of certain carcinogenic compounds. This could have an implication on public health by reducing the harmful effects related to smoking and developing a personalized smoking cessation according to their individual genotype (Liu et al., 2011[74]; Schoedel et al., 2004[117]). However, these alleles have a specific distribution in worldwide populations.

Population Distribution of CYP2A6 Alleles

The CYP2A6 allele distribution has an interethnic pattern. Knowing the individual differences in nicotine metabolism may allow us to answer the following questions: Why do some people become regular smokers after initial exposure, while others experience negative reactions and discontinue use? Why do some people smoke in greater quantities than others? Why do different individuals not respond the same way to drug therapies to quit smoking? Why do some individuals develop smoking related diseases faster than others? (O'Loughlin et al., 2004[99]; Schoedel et al., 2004[117]; Swan et al, 1997[128], 2005[127]).

Therefore, we present the allele frequencies in reported populations where tobacco consumption, cancer and nicotine metabolism were studied and in cohorts and general population studies, which involve CYP2A6. The number of reports of each allele according to a population group is summarized in Figure 2(Fig. 2). For more practical reasons, we only showed the frequency without distinction for alleles with subvariants, except for the wild-type allele CYP2A6*1 whose frequency was not completely calculated because some studies assign an unidentified genotype to the reference allele.

The wild-type allele subvariants are distributed in a particular way on worldwide populations. CYP2A6*1A is found in almost all populations studied such as Caucasian populations (Spanish, British, French, Swedish and Serbian), which range from 57-67 % (Djordjevic et al., 2010[30], 2013[31]; Gambier et al., 2005[42]; Huang et al., 2005[54]; Nakajima et al., 2006[91], 2004[95]; Oscarson, et al., 1999[102]; Soriano et al., 2011[124]), Africans, and Ethiopians, which reported an allele frequency of 34.8 % (Aklillu et al., 2014[1]). However, in African Americans, Ghanaians and Namibians the frequencies were between 66.5-80.5 % (Gyamfi et al., 2005[45]; Nakajima et al., 2004[95]; Takeshita et al., 2006[129]) while it was the opposite in Asians. Asians living in the UK report a frequency of 64.1 % while East and South Asian populations (Chinese, Japanese, Korean, Malaysian, Thai, Indian, Bangladeshi and Sri Lankan) report a frequency of 27-52 % (Ariyoshi et al., 2002[6]; Djordjevic et al., 2013[31]; Islam et al., 2013[59]; Ito et al., 2015[60]; Iwahashi et al., 2004[61]; Kwon et al., 2001[70]; Mahavorasirikul et al., 2009[79]; Nakajima et al., 2001[92], 2006[91]; Nurfadhlina et al., 2006[98]; Oscarson et al., 1999[102]; Peamkrasatam et al., 2006[107]; Takeshita et al., 2006[129]; Topcu et al., 2002[137]; Yoshida et al., 2002[150]). In the Middle East, the Turkish report a frequency of 23.9-69.7 % (Takeshita et al., 2006[129]; von Richter et al. (2004[142]). The American mestizo populations such as Brazilian and Ecuadorian show a frequency of 71.7 % (Rossini et al., 2006[115]) and 61.7 % (Soriano et al., 2011[124]), respectively. CYP2A6*1B frequency is higher in East and South Asian populations and is reported as 26.7-54.2 % (Ariyoshi et al., 2002[6]; Djordjevic et al., 2013[31]; Islam et al., 2013[59]; Ito et al., 2015[60]; Iwahashi et al., 2004[61]; Kwon et al., 2001[70]; Lourembam et al., 2015[77]; Mahavorasirikul et al., 2009[79]; Nakajima et al., 2001[92], 2006[91]; Nurfadhlina et al., 2006[98]; Oscarson et al., 1999[102]; Peamkrasatam et al., 2006[107]; Schoedel et al., 2004[117]; Takeshita et al., 2006[129]; Tiwawech et al., 2006[136]; Topcu et al., 2002[137]; Yoshida et al., 2002[150]; Yusof and Gan, 2009[152]). In Caucasians (Nonspecific, North American, Spanish, British, French, Swedish and Serbian) a frequency of 27.6-33.5 % (Bloom et al., 2011[17]; Djordjevic et al., 2013[31], 2010[30]; Gambier et al., 2005[42]; Haberl et al., 2005[46]; Huang et al., 2005[54]; Nakajima et al., 2006[91], 2004[95]; Oscarson et al., 1999[102]; Schoedel et al., 2004[117]; Soriano et al., 2011[124]) is reported, but it is lower in Turkish populations (25.9-26.7 % (Takeshita et al., 2006[129]; von Richter et al., 2004[142])). African populations such as African American, Ghanaian and Namibian show lower frequencies (11.2-19.8 % (Gyamfi et al., 2005[45]; Ho et al., 2009[49]; Mwenifumbo et al., 2008[87]; Nakajima et al., 2006[91], 2004[95]; Schoedel et al., 2004[117]; Takeshita et al., 2006[129])), except for Ethiopian populations (31.3 % (Aklillu et al., 2014[1])). American mestizo populations (Brazilian and Ecuadorian) have a frequency of 26.4-31.2 % (Rossini et al., 2006[115]; Soriano et al., 2011[124]; Vasconcelos et al., 2005[139]) while the Native Canadian and Alaskan Yupik show a frequency of 55-65.3 % (Rossini et al., 2006[115]; Soriano et al., 2011[124]; Vasconcelos et al., 2005[139]). CYP2A6*1D showed a higher frequency in the African nonspecific population (>50 % (Nakajima et al., 2006[91])) than in the Ethiopian population (29.4 %) (Aklillu et al., 2014[1]). In the Caucasian population (Nonspecific, North American and Swedish) the frequency is 26.7-40 % (Bloom et al., 2011[17]; Nakajima et al., 2006[91]; von Richter et al., 2004[142]) and in Turkish populations it is 32.3 % (von Richter et al., 2004[142]). Asian populations (Japanese and Korean) show a frequency of 10-20 % (Nakajima et al., 2006[91]). CYP2A6*1F has been reported only in nonspecific Caucasian (1.8 % (Nakajima et al., 2004[95])) and Turkish (2.2 % (Takeshita et al., 2006[129])) populations, but was not found in African and Japanese populations (Nakajima et al., 2004[95]; Takeshita et al., 2006[129]). CYP2A6*1G has a higher frequency in African populations (North American and Namibian) (12.3-13.3 % (Nakajima et al., 2004[95]; Takeshita et al., 2006[129])) than in Caucasian populations (1.2 % (Nakajima et al., 2004[95])), but it was not reported in Turkish and Japanese populations (Takeshita et al., 2006[129]). CYP2A6*1H has been found higher in Caucasian populations such as nonspecific Caucasian (>11 % (Nakajima et al., 2006[91])), North American (7.9 % (Bloom et al., 2011[17])) and Swedish (3.1 % (von Richter et al., 2004[142])), followed by nonspecific African (9.8 % (Nakajima et al., 2006[91])), Turkish (5.2 % (von Richter et al., 2004[142])), Japanese (4.5 % (Nakajima et al., 2006[91])) and Korean (1.6 % (Nakajima et al., 2006[91])). CYP2A6*1J has been reported as non-existent in Caucasian, African, Japanese and Korean populations (Nakajima et al., 2006[91]).

CYP2A6*2 has a higher frequency in Caucasian populations such as nonspecific Caucasian (1.1-5.3 % (Audrain-McGovern et al., 2007[9]; Benowitz et al., 2006[13]; Haberl et al., 2005[46]; Malaiyandi et al., 2006[80][81]; Nakajima et al., 2006[91], 2004[95]; Paschke et al., 2001[106]; Rao et al., 2000[112]; Schoedel et al., 2004[117]; Xu et al., 2002[147])), English populations such as British (2.5 % (Huang et al., 2005[54])) and Canadian (3.4 % (O'Loughlin et al., 2004[99])); and in Central Europe populations such as German, French and Spanish it has been reported from 2.3-3 % (Bourian et al., 2000[19]; Loriot et al., 2001[76]; Oscarson, et al., 1999[103])). In North of Europe populations such as Finish and Swedish, a frequency of 1.1-3 % (Oscarson et al., 1998[100], 1999[103]) was reported. In African populations (Afro American and Ethiopian), the frequency is less than 1 % (Malaiyandi et al., 2005[82]; Nakajima et al., 2006[95]; Schoedel et al., 2004[117]) and is not reported in Ghanaian populations (Gyamfi et al., 2005[45]). The frequency is different in American populations: Amerindian populations, Canadian natives and Alaskan Yupik have a frequency less than 1 % (Binnington et al., 2012[16]; Nowak et al., 1998[96]; Schoedel et al., 2004[117]). However, the mestizo populations such as Brazilian (1.6-1.7 %) (Rossini et al., 2006[115]; Vasconcelos et al., 2005[139]) and Chilean (2-3.7 %) (Cáceres et al., 2012[20]; Roco et al., 2012[114]) show a frequency higher than Hispanics (Benowitz et al., 2006[13]). In East and Southeast Asian populations such as Chinese, Korean, Japanese, Malaysian and Thai, CYP2A6*2 is non-existent (Huang et al., 2005[54]; Kitagawa et al., 1999[62]; Malaiyandi et al., 2005[82]; Nakajima et al., 2006[91]; Nurfadhlina et al., 2006[98]; Oscarson et al., 1999[103]; Schoedel et al., 2004[117]). A minimum range of 1 % (Nurfadhlina et al., 2006[98]) was reported in Indians. The Iranian population had a frequency higher than 2.2 % (Emamghoreishi et al., 2008[32]; Heravi et al., 2010[48]), unlike the Turkish population where CYP2A6*2 was not found (Cok et al., 2001[23]).

The methodologies for the detection, function and allelic frequency of CYP2A6*3 have been controversial (Fernandez-Salguero et al., 1995[34]; Oscarson et al., 1998[100]; Yamano et al., 1990[148]); however, we present the reported frequency. The highest frequency (13.8 % (Nowak et al., 1998[96])) was reported in Canadian natives, followed by Turkish (12 % (Cok et al., 2001[23])), German (1.4 %) (Bourian et al., 2000[19]) and Indian (1.1 %) (Nurfadhlina et al., 2006[98]) populations. However, in African (Nakajima et al., 2006[91]; Paschke et al., 2001[106]). Caucasian (Nakajima et al., 2006[91]; Paschke et al., 2001[106]), Spanish (Oscarson et al., 1999[102]), Chilean (Cáceres et al., 2012[20]), Iranian (Heravi et al., 2010[48]), Korean (Kwon et al., 2001[70]; Nakajima et al., 2006[91]; Yoshida et al., 2002[150]), Chinese (Nurfadhlina et al., 2006[98]; Oscarson et al., 1999[103]), Malaysian (Nurfadhlina et al., 2006[98]) and Japanese (Nakajima et al., 2001[92], 2006[91]; Yoshida et al., 2002[150]) (except a report of 0.2 % (Minematsu et al., 2003[85])) populations, this allele was not found.

CYP2A6*4 may be the most widely studied allele in all populations. East Asian populations such as Japanese (11.2-25.6 % (Ariyoshi et al., 2002[6]; Fujieda et al., 2004[36]; Fukami et al., 2006[39]; Ito et al., 2015[60]; Iwahashi et al., 2004[61]; Minematsu et al., 2003[85], 2006[84]; Nakajima et al., 2001[92], 2006[91]; Schoedel et al., 2004[117]; Takeshita et al., 2006[129]; Tamaki et al., 2011[130]; Xu et al., 2002[147]; Yoshida et al., 2002[150])), Chinese (4.9-14 % (Gu et al, 2005[44]; Liu et al., 2011[74]; Nurfadhlina et al., 2006[98]; Oscarson et al., 1999[102]; Schoedel et al., 2004[117]; Song et al., 2009[123]; Tan et al., 2001[131]; Xu et al., 2002[147]; Yuan et al., 2016[151])), Korean (9.4-11 %) (Djordjevic et al., 2013[31]; Fukami et al., 2006[39]; Kwon et al., 2001[70]; Nakajima et al., 2006[91]; Yoshida et al., 2002[150]), Thai (4-14.2 % (Mahavorasirikul et al., 2009[79]; Peamkrasatam et al., 2006[107]; Tiwawech et al., 2006[136])), Malaysian (7-16.7 % (Nurfadhlina et al., 2006[98]; Yusof and Gan, 2009[152])) and Vietnamese (11.8 % (Veiga et al., 2009[140])) showed the highest frequency among populations. However, some Asian populations that reside in a foreign country such as those living in the UK report a frequency of less than 1 % (Benowitz et al., 2006[13]; Huang et al., 2005[54]). However, ethnic populations in Asian countries show no differences in the frequencies such as in Japan with the Shimane (18.2 %), Tottori (16.9 %), Fukoka (20.6 %) and Ehime (25.9 % (Takeshita et al., 2006[129]) and in China with the Han (7.9 %), Uighur (15 %), Bouyei (0 %) and Tibetan (2 %) (Pang et al., 2015[105]). South Asian populations such as Bangladeshi (4.7-11.2 % (Islam et al., 2013[59])), Sri Lankan (2.8-9.6 % (Topcu et al., 2002[137])) and Indian (1.5-8.9 % (Krishnakumar et al., 2012[67]; Nurfadhlina et al., 2006[98]) show a high frequency. Middle East populations such as Turkish (2.2 % (Takeshita et al., 2006[129])) and Iranian (0.9-2.5 % (Emamghoreishi et al., 2008[32]; Heravi et al., 2010[48])) show a lower frequency. However, the distribution is different in Caucasian populations: Nonspecific Caucasians had a frequency lower than 3 % (Audrain-McGovern et al., 2007[9]; Benowitz et al., 2006[13]; Fukami et al., 2006[39]; Malaiyandi et al., 2006[80][81]; Nakajima et al., 2006[91], 2004[95]; Rao et al., 2000[112]; Schoedel et al., 2004[117]; Xu et al., 2002[147]); Atlantic Europe populations such as Spanish (0.5-4 % (Oscarson et al., 1999[103]; Soriano et al., 2011[124])) and French (3.8 % (Gambier et al., 2005[42])) also have this allele; English populations such as British (0.3 % (Huang et al., 2005[54])), North American (1.6 % (Bloom et al., 2011[17])) and Canadian (0.2 % (O'Loughlin et al., 2004[99])) had a lower frequency; North of Europe populations such as Finish (1 % (Oscarson et al., 1999[103])) and Swedish (1.1 % (Djordjevic et al., 2013[31])) also report this allele. Southeastern Europe populations such as Serbian report a frequency of 2.9 % (Djordjevic et al., 2010[30]) and Tatar from Russia reported a frequency range from 6.8-16.9 % (Korytina et al., 2014[66]). African populations had a frequency less than 2 % and are reported as follows: Nonspecific African (≤1.9 % (Ho et al., 2009[49]; Nakajima et al., 2006[91]; Schoedel et al., 2004[117])), African American (0.5-0.6 % (Fukami et al., 2006[39]; Nakajima et al., 2004[95])), Ghanaian (2 % (Gyamfi et al., 2005[45])), Ethiopian (0.6 % (Aklillu et al., 2014[1])) and Namibian (0 % (Takeshita et al., 2006[129])). American populations show a variable frequency: Amerindian populations as Alaskan Yupik (14.5 % (Binnington et al., 2012[16])) have a higher frequency than Canadian natives (1 % (Schoedel et al., 2004[117])) and more than mestizo populations as Brazilian (0.5 % (Vasconcelos et al., 2005[139])), Ecuadorian (7.1 % (Soriano et al., 2011[124])), Chilean (3.7-4 % (Cáceres et al., 2012[20]; Roco et al., 2012[114])) and Hispanics (0 % (Benowitz et al., 2006[13])). On the other side of the world, the Māori native population from New Zealand report a high frequency (9.6 % (Lea et al., 2008[71])) of this allele and it is the only population reported in Oceania.

CYP2A6*5 is found in a higher frequency in Asian populations, East and Southeast Asian populations such as the Vietnamese had the highest frequency (14.6 % (Veiga et al., 2009[140])) compared with the Chinese (Liu et al., 2011[74]; Nurfadhlina et al., 2006[98]; Oscarson et al., 1999[103]; Schoedel et al., 2004[117]), Korean (Djordjevic et al., 2013[31]; Kwon et al., 2001[70]; Nakajima et al., 2006[91]; Yoshida et al., 2002[150]) and Malaysian (Nurfadhlina et al., 2006[98]) populations with a frequency less than 1.5 %. However, this allele is not found in the Japanese (Nakajima et al., 2001[92], 2006[91]; Schoedel et al., 2004[117]; Yoshida et al., 2002[150]); South Asians such as Indians show a frequency of less than 1 % (Krishnakumar et al., 2012[67]; Nurfadhlina et al., 2006[98]). Canadian populations such as the natives (0.5 % (Schoedel et al., 2004[117])) and Caucasians (0.1 % (Schoedel et al., 2004[117])) showed the minimum frequency. However, this allele was not found in the African, Caucasian, Middle East and American mestizo populations (Aklillu et al., 2014[1]; Djordjevic et al., 2013[31], 2010[30]; Gyamfi et al., 2005[45]; Huang et al., 2005[54]; Malaiyandi et al., 2006[80]; Nakajima et al., 2006[91]; Oscarson et al., 1999[103]; Rossini et al., 2006[115]).

CYP2A6*6 has been found only in a Japanese population study at a low frequency (0.4 % (Kitagawa et al., 2001[63])). It not has been found in African (Gyamfi et al., 2005[45]; Nakajima et al., 2006[91]), Caucasian (Malaiyandi et al., 2006[80]; Nakajima et al., 2006[91]), Asian (Nakajima et al., 2006[91]; Yoshida et al., 2002[150]) or Canadian native populations (Schoedel et al., 2004[117]).

CYP2A6*7 has a higher frequency in East and Southeast Asian populations such as Japanese (6.3-13 %) (Fujieda et al., 2004[36]; Fukami et al., 2005[38]; Minematsu et al., 2006[84]; Mwenifumbo et al., 2005[88]; Nakajima et al., 2006[91]; Schoedel et al., 2004[117]; Xu et al., 2002[147]; Yoshida et al., 2002[150]), Chinese (2.2-13.8 % (Liu et al., 2011[74]; Mwenifumbo et al., 2005[88]; Nurfadhlina et al., 2006[98]; Schoedel et al., 2004[117]; Xu et al., 2002[147]; Yuan et al., 2016[151])), Korean (3.6-11.1 % (Djordjevic et al., 2013[31]; Fukami et al., 2005[38]; Mwenifumbo et al., 2005[88]; Nakajima et al., 2006[91]; Yoshida et al., 2002[150])), Taiwanese (10 % (Mwenifumbo et al., 2005[88])), Thai (5-6.4 % (Mahavorasirikul et al., 2009[79]; Peamkrasatam et al., 2006[107])) and Malaysian (4.3 % (Nurfadhlina et al., 2006[98]; Yusof and Gan, 2009[152])) populations. It has also been reported in a lower frequency in Caucasian (≤0.3 % (Fukami, et al., 2005[38]; Malaiyandi et al., 2006[80]; Mwenifumbo et al., 2005[88]; Nakajima et al., 2006[91]; Schoedel et al., 2004[117]; Xu et al., 2002[147])) and Māori natives from New Zealand (1 % (Lea et al., 2008[71])). On the other hand, in Indian, African, Canadian native and Alaskan Yupik populations, this allele is not found (Binnington et al., 2012[16]; Fukami et al., 2005[38]; Gyamfi et al., 2005[45]; Mwenifumbo et al., 2005[88]; Nakajima et al., 2006[91]; Nurfadhlina et al., 2006[98]; Schoedel et al., 2004[117]).

CYP2A6*8 has a specific frequency in Asian populations such as Malaysian (4.2-5 % (Nurfadhlina et al., 2006[98]; Yusof and Gan, 2009[152]), Chinese (≤3.6 % (Nurfadhlina et al., 2006[98]; Schoedel et al., 2004[117]; Xu et al., 2002[147])), Japanese and Korean (≤2.2 % (Djordjevic et al., 2013[31]; Mwenifumbo et al., 2005[88]; Nakajima et al., 2006[91]; Schoedel et al., 2004[117]; Xu et al., 2002[147]; Yoshida et al., 2002[150])), Indian (0.9 % (Nurfadhlina et al., 2006[98])), Thai (≤0.5 % (Mahavorasirikul et al., 2009[79]; Peamkrasatam et al., 2006[107])) and is the lowest in Taiwanese (0.2 % (Mwenifumbo et al., 2005[88])). However, it has not been found in African, Caucasian, Canadian natives and Alaskan Yupik populations (Binnington et al., 2012[16]; Gyamfi et al., 2005[45]; Malaiyandi et al., 2006[80]; Mwenifumbo et al., 2005[88]; Nakajima et al., 2006[91]; Schoedel et al., 2004[117]; Xu et al., 2002[147]).

CYP2A6*9 is the most widely studied decreased function allele. Asian populations show the highest frequency: East Asian populations (Chinese, Korean and Japanese) had a frequency between 15-20 % (Benowitz et al., 2006[13]; Djordjevic et al., 2013[31]; Fujieda et al., 2004[36]; Liu et al., 2011[74]; Minematsu et al., 2006[84]; Nakajima et al., 2006[91]; Pitarque et al., 2001[110]; Schoedel et al., 2004[117]; Yoshida et al., 2003[149]; Yuan et al., 2016[151]), followed by South Asian population as Thai (12.1-20.4 % (Mahavorasirikul et al., 2009[79]; Peamkrasatam et al., 2006[107])) and Malaysian (10.4 % (Yusof and Gan, 2009[152])); Middle East populations as Turkish (6.9-7.2 % (Pitarque et al., 2001[110]; von Richter et al., 2004[142])), Iranian (12.4 % (Emamghoreishi et al., 2008[32])) and some ethnic groups among them (Sepehr et al., 2004[119]) such as Turkomans (14 %), Turks (5 %) and Zoroastrian Persian (4 %) showed a high frequency. Mediterranean European (Spanish (Soriano et al., 2011[124]) and Serbian (Djordjevic et al., 2010[30])), North European (Swedish (Djordjevic et al., 2013[31]; Pitarque et al., 2001[110])) and Central European (Hungarian (Fiatal et al., 2016[35])) populations show a frequency range of 5-8 %, which is the same as Caucasian (Audrain-McGovern et al., 2007[9]; Benowitz et al., 2006[13]; Haberl et al., 2005[46]; Malaiyandi et al., 2006[80][81]; Nakajima et al., 2006[91], 2004[95]; Schoedel et al., 2004[117]) and North American Caucasian populations (Bloom et al., 2011[17]; O'Loughlin et al., 2004[99]). A different pattern occurs in African populations; African and African American show a frequency of 7-10 % (Ho et al., 2009[49]; Mwenifumbo et al., 2008[87]; Nakajima et al., 2006[91], 2004[95]; Schoedel et al., 2004[117]), but in populations with a more conserved African component as Ghanaian (5.7 % (Gyamfi et al., 2005[45])) and Ethiopian (2.8 % (Aklillu et al., 2014[1])) the frequency is lower. Amerindian populations such as Canadian natives (15.5 % (Schoedel et al., 2004[117])) and Alaskan Yupik (8.9 % (Binnington et al., 2012[16])) had a heterogeneous frequency, which was the same as American mestizo populations such as Brazilian (5.7 % (Vasconcelos et al., 2005[139])), Ecuadorian (10.3 % (Soriano et al., 2011[124])), Mexican (16.4 % (Svyryd et al., 2015[126])) and other Hispanics (7.1 % (Benowitz et al., 2006[13])). The only population in Oceania to report this allele is the native population Māori from New Zealand with 19 % (Lea et al., 2008[71]).

CYP2A6*10 has been reported to be higher among Asian populations as Japanese (1-4.3 %) (Fujieda et al., 2004[36]; Mwenifumbo et al., 2005[88]; Nakajima et al., 2006[91]; Schoedel et al., 2004[117]; Xu et al., 2002[147]; Yoshida et al., 2002[150]), Chinese (0.4-4.3 % (Liu et al., 2011[74]; Mwenifumbo et al., 2005[88]; Nurfadhlina et al., 2006[98]; Schoedel et al., 2004[117]; Xu et al., 2002[147])), Korean (0.5-4.2 %) (Djordjevic et al., 2013[31]; Mwenifumbo et al., 2005[88]; Nakajima et al., 2006[91]; Yoshida et al., 2002[150]), Malaysian (4.3 %) (Nurfadhlina et al., 2006[98]), Taiwanese (4.1 %) (Mwenifumbo et al., 2005[88]) and Thai (1.6-2.4 %) (Mahavorasirikul et al., 2009[79]; Peamkrasatam et al., 2006[107]); and the Alaskan Yupik population with 1.9 % (Binnington et al., 2012[16]). However, Indian (Nurfadhlina et al., 2006[98]), Caucasian (Malaiyandi et al., 2006[80]; Mwenifumbo et al., 2005[88]; Nakajima et al., 2006[91]; Schoedel et al., 2004[117]; Xu et al., 2002[147]), African (Gyamfi et al., 2005[45]; Mwenifumbo et al., 2005[88]; Nakajima et al., 2006[91]; Schoedel et al., 2004[117]) and even Canadian native populations (Schoedel et al., 2004[117]) do not show any frequency.

CYP2A6*11 is not well-reported. However, it has been reported in a minimum frequency in Japanese and Korean populations at 0.5-0.7 % (Fujieda et al., 2004[36]; Nakajima et al., 2006[91]). The few analyzed African and Caucasian populations did not report this allele.

CYP2A6*12 has been reported at the highest frequency among the studied populations in Hispanics (3.5-4.7 % (Benowitz et al., 2006[13]; Koontz et al., 2009[65])) and Mexican (3.5 % (Borrego-Soto et al., 2015[18])) population. The frequency decreases in Caucasians (≤3 % (Audrain-McGovern et al., 2007[9]; Benowitz et al., 2006[13]; Haberl et al., 2005[46]; Koontz et al., 2009[65]; Malaiyandi et al., 2006[80][81]; Nakajima et al., 2006[91]; Schoedel et al., 2004[117])), Spanish (2.2 % (Oscarson et al., 2002[101])) and Canadian populations (1.1 % (O'Loughlin et al., 2004[99])). Then, in Asians, similar to in Middle East populations such as Iranians, it is reported in 1.3 % (Emamghoreishi et al., 2008[32]), but in East Asia only Japanese had a minimum frequency (0.8 % (Nakajima et al., 2006[91]; Schoedel et al., 2004[117])) while Chinese and Korean populations (Benowitz et al., 2006[13]; Koontz et al., 2009[65]; Nakajima et al., 2006[91]; Oscarson et al., 2002[101]; Schoedel et al., 2004[117]) did not report any frequency of the allele. Lastly, Amerindian populations such as Canadian natives and Alaskan Yupik reported a very low frequency (0.4-0.5 % (Binnington et al., 2012[16]; Schoedel et al., 2004[117])). In African populations, some studies show a low frequency (0.4 %) (Ho et al., 2009[49]; Schoedel et al., 2004[117]) and others do not show any frequency (Benowitz et al., 2006[13]; Koontz et al., 2009[65]; Mwenifumbo et al., 2008[87]; Nakajima et al., 2006[91]).

CYP2A6*13 has been reported in Japanese (1.1-1.5 % (Kiyotani et al., 2002[64]; Nakajima et al., 2006[91])) and Koreans (0.2 % (Nakajima et al., 2006[91])). It was not found in Caucasians and Africans (Kiyotani et al., 2002[64]; Nakajima et al., 2006[91]).

CYP2A6*14 has a higher frequency in Caucasian (3.5-5.2 % (Haberl et al., 2005[46]; Kiyotani et al., 2002[64]; Nakajima et al., 2006[91])) than in African (0.9-1.4 % (Mwenifumbo et al., 2008[87]; Nakajima et al., 2006[91])), but was not reported in Asians (Japanese and Korean) (Kiyotani et al., 2002[64]; Nakajima et al., 2006[91]).

CYP2A6*15 has been reported at a minimum frequency in Japanese (1.5-2.2 % (Kiyotani et al., 2002[64]; Nakajima et al., 2006[91])) and Korean (1.2 % (Nakajima et al., 2006[91])), but not in Caucasian and African populations (Kiyotani et al., 2002[64]; Mwenifumbo et al., 2008[87]; Nakajima et al., 2006[91]).

CYP2A6*16 has been reported in Caucasian (0.3-3.6 %) and African (0-1.7 %) populations (Kiyotani et al., 2002[64]; Mwenifumbo et al., 2008[87]; Nakajima et al., 2006[91]), but not in Japanese or Korean populations (Kiyotani et al., 2002[64]; Nakajima et al., 2006[91]).

CYP2A6*17 has a frequency of approximately 7.3-10.5 % in African populations (Fukami et al., 2004[41]; Ho et al., 2009[49]; Mwenifumbo et al., 2008[87]; Nakajima et al., 2006[91]), but not in Caucasian, Korean, Japanese or Alaskan Yupik (Binnington et al., 2012[16]; Fukami et al., 2004[41]; Nakajima et al., 2006[91]) populations.

CYP2A6*18 has a higher frequency range in Caucasian (0.3-2.2 % (Fukami et al., 2005[38]; Haberl et al., 2005[46]; Nakajima et al., 2006[91])) than in Korean (0.3-0.5 % (Fukami et al., 2005[38]; Nakajima et al., 2006[91])), but has not been found in Japanese and African populations (Fukami et al., 2005[38]; Nakajima et al., 2006[91]).

CYP2A6*19 has been reported in a low frequency in Korean (1-1.4 % (Djordjevic et al., 2013[31]; Fukami et al., 2005[38]; Nakajima et al., 2006[91])) and Japanese (0.5 % ), but not in Caucasian nor African (Fukami et al., 2005[38]; Nakajima et al., 2006[91]) populations.

CYP2A6*20 is present in African population at a frequency range between 1-1.7 % (Fukami et al., 2005[37]; Ho et al., 2009[49]; Mwenifumbo et al., 2008[87]; Nakajima et al., 2006[91]). This allele was not reported in Caucasian, Japanese and Korean populations (Fukami et al., 2005[37]; Nakajima et al., 2006[91]).

CYP2A6*21 has a higher frequency in Caucasian (0.5-2.3 %) (Al Koudsi et al., 2006[3]; Haberl et al., 2005[46]; Nakajima et al., 2006[91]) than in African populations (0.6-0.7 % (Mwenifumbo et al., 2008[87]; Nakajima et al., 2006[91])). It has not been reported in Japanese or Korean (Nakajima et al., 2006[91]) populations.

CYP2A6*22 has been reported at frequency less than 0.3 % (Haberl et al., 2005[2]; Nakajima et al., 2006[91]) in Caucasian populations, but not in Japanese or Korean (Nakajima et al., 2006[91]) populations.

CYP2A6*23 has a frequency range among 1-2 % (Ho et al., 2009[49], 2008[50]; Mwenifumbo et al., 2008[87]) in African populations, but was not reported in Caucasian, Japanese or Chinese populations (Ho et al., 2008[50]).

CYP2A6*24 has a frequency range among 0.7-1.3 % in African populations (Al Koudsi et al., 2010[2]; Ho et al., 2009[49]; Mwenifumbo et al., 2008[87]), but it has not been found in Caucasian, Chinese, Japanese and Taiwanese (Al Koudsi et al., 2010[2]) populations.

CYP2A6*25-*28 has only been reported in African populations, while CYP2A6*26-*27 has a frequency range of 0.7-0.9 % (Ho et al., 2009[49]; Mwenifumbo et al., 2008[87]) and CYP2A6*28 from 0.9-2.4 % (Ho et al., 2009[49]; Mwenifumbo et al., 2008[87]).

CYP2A6*31, *34 and *38 have not been studied in any population.

CYP2A6*35 has been reported at a frequency between 2.5-2.9 % (Al Koudsi et al., 2010[2]; Ho et al., 2009[49]) in African populations living in North American countries. In East Asian populations, such as Chinese, Japanese and Taiwanese, it has been found at a frequency of 0.5-0.8 % (Al Koudsi et al., 2010[2]), but it has not been found in Caucasian or Alaska Yupik (Al Koudsi et al., 2010[2]; Binnington et al., 2012[16]) populations.

CYP2A6*36 and *37 has been reported in Taiwanese populations at a frequency of 0.3 %, but not in African, Caucasian, Chinese nor Japanese (Al Koudsi et al., 2010[2]) populations.

CYP2A6*39 (0.6 %), *40 (0.2 %), *41 (1.2 %), *42 (0.2 %), *43 (0.2 %), *44 (0.2 %) and *45 (0.6 %) have only been reported in the African population (Piliguian et al., 2014[109]).

The gene duplication, CYP2A6*1X2, has been found at higher frequency in Asian populations as Asian (7.1 % (Benowitz et al., 2006[13])), Indian (3.5 % (Nurfadhlina et al., 2006[98])), Chinese (0.4-1.5 %) (Nurfadhlina et al., 2006[98]; Schoedel et al., 2004[117]; Xu et al., 2002[147]), Korean (≤0.2 %) (Fukami et al., 2007[40]; Nakajima et al., 2006[91]) and Malaysian (0.4 %) (Nurfadhlina et al., 2006[98]); the Hispanic population (3.5 %) (Benowitz et al., 2006[13]) has a higher frequency than the Ecuadorian population (0.5 %) (Soriano et al., 2011[124]); Caucasian populations have a frequency less than 2 % as in some Caucasian groups (≤1.7 %) (Benowitz et al., 2006[13]; Fukami et al., 2007[40]; Nakajima et al., 2006[91]; Rao et al., 2000[112]; Schoedel et al., 2004[117]; Xu et al., 2002[147]), Spanish (1.2 %) (Soriano et al., 2011[124]), Swedish (0.8 %) (Djordjevic et al., 2013[31]), Serbian (0.4 %) (Djordjevic et al., 2010[30]), North American (0.3 %) (Bloom et al., 2011[17]) and Canadian (0.2 %) (O'Loughlin et al., 2004[99]). In African populations, such African American (1.7 % (Fukami et al., 2007[40])) and Ethiopian (0.3 % (Aklillu et al., 2014[1])), this allele was present, but was not found in other African groups, Canadian natives or Alaskan Yupik (Binnington et al., 2012[16]; Nakajima et al., 2006[91]; Schoedel et al., 2004[117]).

Most studies address the majority of a country's population as a general population. However, a few studies focus on more specific population classifications as ethnic and regional groups. In the Asian population, it was studied among Tottori, Shimane, Ehime and Fukuoka people of the respective districts of Yonago, Izumo, Matsuyama and Kurume located in Japan (Takeshita et al., 2006[129]). In China, it has been compared in the prevailing Han Chinese group and the Uighur, Bouyei and Tibetan ethnic groups (Pang et al., 2015[105]). In the South of India, the frequencies of the people from Andhra Pradesh, Karnataka, Kerala and Tamil Nadu regions (Krishnakumar et al., 2012[67]) were compared. In Iran, some ethnic groups such as Turkomans from the Golestan Province, Turks from the Ardabil Province and Zoroastrian Persians from Tehran (Sepehr et al., 2004[119]) were studied. In Russia, the Tatar ethnic group was reported (Korytina et al., 2014[66]). In African populations, the ethnic group Ovambo from Namibia was reported (Takeshita et al., 2006[129]); and some ethnic groups such as Akan, Guan, Ewe, Ga, Nzima and Dargarti, but there were a few participants that were added in a single Ghanaian population (Gyamfi et al., 2005[45]). In Oceania, the Māori ethnic group from New Zealand is the only population reported across the continent (Lea et al., 2008[71]). In the American continent, the ethnic groups such as Yupik from Alaska and Canadian natives have been reported (Binnington et al., 2012[16]; Nowak et al., 1998[96]; Schoedel et al., 2004[117]).

Conclusions and Perspectives

The enzyme responsible for metabolizing nicotine is mostly encoded by the CYP2A6 gene, which is highly polymorphic. This variability is due to changes in DNA, which have generated different responses to nicotine and are reflected in the individual smoking behaviors along with other factors. It has been reported that this variability has been generated and distributed over a long time in different human populations, showing well defined ethnic patterns. Although association studies between carriers of certain variants and different smoking behaviors have been numerous with plausible results, population studies reporting frequencies of these variants are few. General population studies exhibit most reliable information than association studies with a variable frequency, because the population requirements are usually more specific, creating a population bias. However, it would be advisable to address this type of methodology in higher risk populations of smoking and those where policies to control smoking are less efficient, and where more smoking-related diseases are reported in the population. Additionally, the population must be characterized by more specific requirements, such as including the ancestry informative markers and avoiding "self-reporting" as the unique classification criteria. While there is a Human CYP-Allele Nomenclature Database in which the genetic findings of CYP2A6 are unified, it is necessary to supplement it with updated data as per the population distribution. All of this could contribute to a personalized system that could detect, prevent and treat populations at risk of smoking, and in consequence, avoid tobacco consumption related diseases.

Aklillu E Djordjevic N Carrillo JA Makonnen E Bertilsson L Ingelman-Sundberg M High CYP2A6 enzyme activity as measured by a caffeine test and unique distribution of CYP2A6 variant alleles in Ethiopian population OMICS 2014 18 446–53 Al Koudsi N Ahluwalia JS Lin S-K Sellers EM Tyndale RF A novel CYP2A6 allele (CYP2A6*35) resulting in an amino acid substitution (Asn438Tyr) is associated with lower CYP2A6 activity in vivo Pharmacogenomics J 2010 9 274–82 Al Koudsi N Mwenifumbo JC Sellers EM Benowitz NL Swan GE Tyndale RF Characterization of the novel CYP2A6*21 allele using in vivo nicotine kinetics Eur J Clin Pharmacol 2006 62 481–4 Al Koudsi N Tyndale RF Genetic influences on smoking:a brief review Ther Drug Monit 2005 27 704–9 Arinami T Ishiguro H Onaivi ES Polymorphisms in genes involved in neurotransmission in relation to smoking Eur J Pharmacol 2000 410 215 226 Ariyoshi N Miyamoto M Umetsu Y Kunitoh H Dosaka-Akita H Sawamura Y-I Genetic polymorphism of CYP2A6 gene and tobacco-induced lung cancer risk in male smokers Cancer Epidemiol Biom Prev 2002 11 890–4 Ariyoshi N Sawamura Y Kamataki T A novel single nucleotide polymorphism altering stability and activity of CYP2a6 Biochem Biophys Res Commun 2001 281 810–4 Ariyoshi N Takahashi Y Miyamoto M Umetsu Y Daigo S Tateishi T Structural characterization of a new variant of the CYP2A6 gene (CYP2A6*1B) apparently diagnosed as heterozygotes of CYP2A6*1A and CYP2A6*4C Pharmacogenetics 2000 10 687–93 Audrain-McGovern J Al Koudsi N Rodriguez D Wileyto EP Shields PG Tyndale RF The role of CYP2A6 in the emergence of nicotine dependence in adolescents Pediatrics 2007 119 e264 e274 Benowitz NL Cigarette smoking and nicotine addiction Med Clin North Am 1992 76 415–37 Benowitz NL Jacob P III Metabolism of nicotine to cotinine studied by a dual stable isotope method Clin Pharmacol Ther 1994 56 483–93 Benowitz NL Jacob P III Sachs DP Deficient C-oxidation of nicotine Clin Pharmacol Ther 1995 57 590–4 Benowitz NL Swan GE Jacob P III Lessov-Schlaggar CN Tyndale RF CYP2A6 genotype and the metabolism and disposition kinetics of nicotine Clin Pharmacol Ther 2006 80 457–67 Bhagwat SV Boyd MR Ravindranath V Multiple forms of cytochrome P450 and associated monooxygenase activities in human brain mitochondria Biochem Pharmacol 2000 59 573–82 Bierut LJ Johnson EO Saccone NL A glimpse into the future - Personalized medicine for smoking cessation Neuropharmacology 2014 76B 592–9 Binnington MJ Zhu AZX Renner CC Lanier AP Hatsukami DK Benowitz NL CYP2A6 and CYP2B6 genetic variation and its association with nicotine metabolism in South Western Alaska Native people Pharmacogenet Genom 2012 22 429–40 Bloom AJ Hinrichs AL Wang JC von Weymarn LB Kharasch ED Bierut LJ The contribution of common CYP2A6 alleles to variation in nicotine metabolism among European Americans Pharmacogenet Genomics 2011 21 403–16 Borrego-Soto G Costilla-Esquivel A Padilla-Rivas GR Cázares-Samaniego PJ Posadas-Valay R Velasco-Castañón JG Análisis de frecuencias alélicas y genotípicas de las variantes CYP2A6*12 y rs16969968 de CHRNA5 y su asociación con el hábito de fumar y el IMC en sujetos jóvenes del noreste de México Rev Med Chil 2015 143 1377–85 Bourian M Gullstén H Legrum W Genetic polymorphism of CYP2A6 in the German population Toxicology 2000 144 129–37 Cáceres DD Alvarado SA Martínez P Quiñones LA Variantes genéticas de CYP2A6 y su relación con la dependencia tabáquica y el hábito de fumar en una muestra individuos chilenos. Un estudio piloto Rev Med Chil 2012 140 436–41 Chenoweth MJ O’Loughlin J Sylvestre M-P Tyndale RF CYP2A6 slow nicotine metabolism is associated with increased quitting by adolescent smokers Pharmacogenet Genom 2013 23 232–5 Chiang H Wang C-K Tsou T-C Differential distribution of CYP2A6 and CYP2A13 in the human respiratory tract Respiration 2012 84 319–26 Cok I Aygün Kocabaş N Cholerton S Karakaya AE Sardaş S Determination of coumarin metabolism in Turkish population Hum Exp Toxicol 2001 20 179–84 Crawford EL Weaver DA DeMuth JP Jackson CM Khuder SA Frampton MW Measurement of cytochrome P450 2A6 and 2E1 gene expression in primary human bronchial epithelial cells Carcinogenesis 1998 19 1867–71 CYP2A6 allele nomenclature 2014 Available from: http://www.cypalleles.ki.se/cyp2a6.htm. Daigo S Takahashi Y Fujieda M Ariyoshi N Yamazaki H Koizumi W A novel mutant allele of the CYP2A6 gene (CYP2A6*11) found in a cancer patient who showed poor metabolic phenotype towards tegafur Pharmacogenetics 2002 12 299–306 Dempsey D Tutka P Jacob P Allen F Schoedel K Tyndale RF Nicotine metabolite ratio as an index of cytochrome P450 2A6 metabolic activity Clin Pharmacol Ther 2004 76 64–72 di Iulio J Fayet A Arab-Alameddine M Rotger M Lubomirov R Cavassini M In vivo analysis of efavirenz metabolism in individuals with impaired CYP2A6 function Pharmacogenet Genom 2009 19 300–9 Ding X Kaminsky LS Human extrahepatic cytochromes P450:function in xenobiotic metabolism and tissue-selective chemical toxicity in the respiratory and gastrointestinal tracts Annu Rev Pharmacol Toxicol 2003 43 149–73 Djordjevic N Carrillo JA Gervasini G Jankovic S Aklillu E In vivo evaluation of CYP2A6 and xanthine oxidase enzyme activities in the Serbian population Eur J Clin Pharmacol 2010 66 571–8 Djordjevic N Carrillo JA van den Broek MPJ Kishikawa J Roh H-K Bertilsson L Comparisons of CYP2A6 genotype and enzyme activity between Swedes and Koreans Drug Metab Pharmacokinet 2013 28 93–7 Emamghoreishi M Bokaee H-R Keshavarz M Ghaderi A Tyndale RF CYP2A6 allele frequencies in an Iranian population Arch Iran Med 2008 11 613–7 Evans WE Relling MV Moving towards individualized medicine with pharmacogenomics Nature 2004 429 464–8 Fernandez-Salguero P Hoffman SM Cholerton S Mohrenweiser H Raunio H Rautio A A genetic polymorphism in coumarin 7-hydroxylation:sequence of the human CYP2A genes and identification of variant CYP2A6 alleles Am J Hum Genet 1995 57 651–60 Fiatal S Tóth R Moravcsik-Kornyicki Á Kósa Z Sándor J McKee M High prevalence of smoking in the Roma population seems to have no genetic background Nicotine Tob Res 2016 18 2260 2267 Fujieda M Yamazaki H Saito T Kiyotani K Gyamfi MA Sakurai M Evaluation of CYP2A6 genetic polymorphisms as determinants of smoking behavior and tobacco-related lung cancer risk in male Japanese smokers Carcinogenesis 2004 25 2451–8 Fukami T Nakajima M Higashi E Yamanaka H McLeod HL Yokoi T A novel CYP2A6*20 allele found in African-American population produces a truncated protein lacking enzymatic activity Biochem Pharmacol 2005 70 801–8 Fukami T Nakajima M Higashi E Yamanaka H Sakai H Mcleod HL Characterization of novel CYP2A6 polymorphic alleles (CYP2A6*18 and CYP2A6*19) that affect enzymatic activity Drug Metab Dispos 2005 33 1202–10 Fukami T Nakajima M Sakai H McLeod HL Yokoi T CYP2A7 polymorphic alleles confound the genotyping of CYP2A6*4A allele Pharmacogenom J 2006 6 401–12 Fukami T Nakajima M Yamanaka H Fukushima Y McLeod HL Yokoi T A novel duplication type of CYP2A6 gene in African-American population Drug Metab Dispos 2007 35 515–20 Fukami T Nakajima M Yoshida R Tsuchiya Y Fujiki Y Katoh M A novel polymorphism of human CYP2A6 gene CYP2A6*17 has an amino acid substitution (V365M) that decreases enzymatic activity in vitro and in vivo Clin Pharmacol Ther 2004 76 519–27 Gambier N Batt A-M Marie B Pfister M Siest G Visvikis-Siest S Association of CYP2A6*1B genetic variant with the amount of smoking in French adults from the Stanislas cohort Pharmacogenom J 2005 5 271–5 Gu DF Hinks LJ Morton NE Day INM The use of long PCR to confirm three common alleles at the CYP2A6 locus and the relationship between genotype and smoking habit Ann Hum Genet 2000 64 383–90 Gu Y Zhang S Lai B Zhan X Zhang Y Frequency of CYP2A6 gene deletion and its relation to risk of lung cancer Zhongguo Fei Ai Za Zhi 2005 8 297–9 Gyamfi MA Fujieda M Kiyotani K Yamazaki H Kamataki T High prevalence of cytochrome P450 2A6*1A alleles in a black African population of Ghana Eur J of Clin Pharmacol 2005 60 855–7 Haberl M Anwald B Klein K Weil R Fuss C Gepdiremen A Three haplotypes associated with CYP2A6 phenotypes in Caucasians Pharmacogenet Genom 2005 15 609–24 Hadidi H Zahlsen K Idle JR Cholerton S A single amino acid substitution (Leu160His) in cytochrome P450 CYP2A6 causes switching from 7-hydroxylation to 3-hydroxylation of coumarin Food Chem Toxicol 1997 35 903–7 Heravi RE Ramezani M Behravan J Association between nicotine metabolism and CYP2A6*1 and CYP2A6*4 genotypes in an Iranian population DNA Cell Biol 2010 29 369–73 Ho MK Mwenifumbo JC Al Koudsi N Okuyemi KS Ahluwalia JS Benowitz NL Association of nicotine metabolite ratio and CYP2A6 genotype with smoking cessation treatment in African-American light smokers Clin Pharmacol Ther 2009 85 635–43 Ho MK Mwenifumbo JC Zhao B Gillam EMJ Tyndale RF A novel CYP2A6 allele, CYP2A6*23, impairs enzyme function in vitro and in vivo and decreases smoking in a population of Black-African descent Pharmacogenet Genom 2008 18 67–75 Hoffman SM Fernandez-Salguero P Gonzalez FJ Mohrenweiser HW Organization and evolution of the cytochrome P450 CYP2A-2B-2F subfamily gene cluster on human chromosome 19 J Mol Evol 1995 41 894–900 Hoffman SM Nelson DR Keeney DS Organization, structure and evolution of the CYP2 gene cluster on human chromosome 19 Pharmacogenetics 2001 11 687–98 Hosono H Kumondai M Arai T Sugimura H Sasaki T Hirasawa N CYP2A6 genetic polymorphism is associated with decreased susceptibility to squamous cell lung cancer in Japanese smokers Drug Metab Pharmacokinet 2015 30 263–8 Huang S Cook DG Hinks LJ Chen X Ye S Gilg JA CYP2A6, MAOA, DBH, DRD4, and 5HT2A genotypes, smoking behaviour and cotinine levels in 1518 UK adolescents Pharmacogenet Genom 2005 15 839–50 Hukkanen J Jacob P III Benowitz NL Metabolism and disposition kinetics of nicotine Pharmacol Rev 2005 57 79–115 Ingelman-Sundberg M Pharmacogenetics of cytochrome P450 and its applications in drug therapy:the past, present and future Trends Pharmacol Sci 2004 25 193–200 Ingelman-Sundberg M Pharmacogenetics: an opportunity for a safer and more efficient pharmacotherapy J Intern Med 2001 250 186–200 Ingelman-Sundberg M The human genome project and novel aspects of cytochrome P450 research Toxicol Appl Pharmacol 2005 207 2 Suppl 52–6 Islam MS Ahmed MU Sayeed MS Maruf AA Mostofa AG Hussain SM Lung cancer risk in relation to nicotinic acetylcholine receptor, CYP2A6 and CYP1A1 genotypes in the Bangladeshi population Clin Chim Acta 2013 416 11–9 Ito T Tsuji M Mori Y Kanda H Hidaka T Kakamu T Effect of CYP2A6*4 genetic polymorphisms on smoking behaviors and nicotine dependence in a general population of japanese men Fukushima J Med Sci 2015 61 125–30 Iwahashi K Waga C Takimoto T Whole deletion of CYP2A6 gene (CYP2A6*4C) and smoking behavior Neuropsychobiology 2004 49 101–4 Kitagawa K Kunugita N Katoh T Yang M Kawamoto T The significance of the homozygous CYP2A6 deletion on nicotine metabolism:a new genotyping method of CYP2A6 using a single PCR-RFLP Biochem Biophys Res Commun 1999 262 146–51 Kitagawa K Kunugita N Kitagawa M Kawamoto T CYP2A6*6, a novel polymorphism in cytochrome p450 2A6, has a single amino acid substitution (R128Q) that inactivates enzymatic activity J Biol Chem 2001 276 17830–5 Kiyotani K Fujieda M Yamazaki H Shimada T Guengerich FP Parkinson A Twenty one novel single nucleotide polymorphisms (SNPs) of the CYP2A6 gene in Japanese and Caucasians Drug Metab Pharmacokinet 2002 17 482–7 Koontz DA Huckins JJ Spencer A Gallagher ML Rapid detection of the CYP2A6*12 hybrid allele by Pyrosequencing technology BMC Med Genet 2009 10 80 Korytina GF Akhmadishina LZ Kochetova OV Burduk YV Aznabaeva YG Zagidullin SZ Association of genes involved in nicotine and tobacco smoke toxicant metabolism (CHRNA3/5, CYP2A6, and NQO1) and DNA repair (XRCC1, XRCC3, XPC, and XPA) with chronic obstructive pulmonary disease Mol Biol 2014 48 823–34 Krishnakumar D Gurusamy U Dhandapani K Surendiran A Baghel R Kukreti R Genetic polymorphisms of drug-metabolizing phase I enzymes CYP2E1, CYP2A6 and CYP3A5 in South Indian population Fund Clin Pharmacol 2012 26 295–306 Kubota T Nakajima-Taniguchi C Fukuda T Funamoto M Maeda M Tange E CYP2A6 polymorphisms are associated with nicotine dependence and influence withdrawal symptoms in smoking cessation Pharmacogenom J 2006 6 115–9 Kumondai M Hosono H Orikasa K Arai Y Arai T Sugimura H Genetic polymorphisms of CYP2A6 in a case-control study on bladder cancer in Japanese smokers Biol Pharm Bull 2016 39 84–9 Kwon J-T Nakajima M Chai S Yom Y-K Kim H-K Yamazaki H Nicotine metabolism and CYP2A6 allele frequencies in Koreans Pharmacogenetics 2001 11 317–23 Lea RA Roberts RL Green MR Kennedy MA Chambers GK Allele frequency differences of cytochrome P450 polymorphisms in a sample of New Zealand Māori N Z Med J 2008 121 33–7 Lerman C Jepson C Wileyto EP Patterson F Schnoll R Mroziewicz M Genetic variation in nicotine metabolism predicts the efficacy of extended-duration transdermal nicotine therapy Clin Pharmacol Ther 2010 87 553–7 Lerman C Niaura R Applying genetic approaches to the treatment of nicotine dependence Oncogene 2002 21 7412–20 Liu T David SP Tyndale RF Wang H Zhou Q Ding P Associations of CYP2A6 genotype with smoking behaviors in southern China Addiction 2011 106 985–94 London SJ Idle JR Daly AK Coetzee GA Genetic variation of CYP2A6, smoking, and risk of cancer The Lancet 1999 353 898–9 Loriot MA Rebuissou S Oscarson M Cenée S Miyamoto M Ariyoshi N Genetic polymorphisms of cytochrome P450 2A6 in a case-control study on lung cancer in a French population Pharmacogenetics 2001 11 39–44 Lourembam DS Singh AR Sharma TD Singh TS Singh TR Singh LS Evaluation of risk factors for nasopharyngeal carcinoma in a high-risk area of India, the northeastern region Asian Pacif J Cancer Prev: APJCP 2015 16 4927–35 Macé K Bowman ED Vautravers P Shields PG Harris CC Pfeifer AMA Characterisation of xenobiotic-metabolising enzyme expression in human bronchial mucosa and peripheral lung tissues Eur J Cancer 1998 34 914–20 Mahavorasirikul W Tassaneeyakul W Satarug S Reungweerayut R Na-Bangchang C Na-Bangchang K CYP2A6 genotypes and coumarin-oxidation phenotypes in a Thai population and their relationship to tobacco smoking Eur J Clin Pharmacol 2009 65 377–84 Malaiyandi V Goodz SD Sellers EM Tyndale RF CYP2A6 genotype, phenotype, and the use of nicotine metabolites as biomarkers during Ad libitum smoking Cancer Epidemiol Biomarkers Prev 2006 15 1812–9 Malaiyandi V Lerman C Benowitz NL Jepson C Patterson F Tyndale RF Impact of CYP2A6 genotype on pretreatment smoking behaviour and nicotine levels from and usage of nicotine replacement therapy Mol Psychiatry 2006 11 400–9 Malaiyandi V Sellers EM Tyndale RF Implications of CYP2A6 genetic variation for smoking behaviors and nicotine dependence Clin Pharmacol Ther 2005 77 145–58 Messina ES Tyndale RF Sellers EM A major role for CYP2A6 in nicotine C-oxidation by human liver microsomes J Pharmacol Exp Ther 1997 282 1608–14 Minematsu N Nakamura H Furuuchi M Nakajima T Takahashi S Tateno H Limitation of cigarette consumption by CYP2A6*4, *7 and *9 polymorphisms Eur Respir J 2006 27 289–92 Minematsu N Nakamura H Iwata M Tateno H Nakajima T Takahashi S Association of CYP2A6 deletion polymorphism with smoking habit and development of pulmonary emphysema Thorax 2003 58 623–8 Miyamoto M Umetsu Y Dosaka-Akita H Sawamura Y Yokota J Kunitoh H CYP2A6 gene deletion reduces susceptibility to lung cancer Biochem Biophys Res Commun 1999 261 658–60 Mwenifumbo JC Al Koudsi N Man KH Zhou Q Hoffmann EB Sellers EM Novel and established CYP2A6 alleles impair in vivo nicotine metabolism in a population of black African descent Hum Mutat 2008 29 679–88 Mwenifumbo JC Myers MG Wall TL Lin S-K Sellers EM Tyndale RF Ethnic variation in CYP2A6*7, CYP2A6*8 and CYP2A6*10 as assessed with a novel haplotyping method Pharmacogenet Genom 2005 15 189–92 Mwenifumbo JC Sellers EM Tyndale RF Nicotine metabolism and CYP2A6 activity in a population of black African descent:Impact of gender and light smoking Drug Alcohol Depend 2007 89 24–33 Mwenifumbo JC Zhou Q Benowitz NL Sellers EM Tyndale RF New CYP2A6 gene deletion and conversion variants in a population of Black African descent Pharmacogenomics 2010 11 189–98 Nakajima M Fukami T Yamanaka H Higashi E Sakai H Yoshida R Comprehensive evaluation of variability in nicotine metabolism and CYP2A6 polymorphic alleles in four ethnic populations Clin Pharmacol Ther 2006 80 282–97 Nakajima M Kwon JT Tanaka N Zenta T Yamamoto Y Yamamoto H Relationship between interindividual differences in nicotine metabolism and CYP2A6 genetic polymorphism in humans Clin Pharmacol Ther 2001 69 72–8 Nakajima M Yamagishi S Yamamoto H Yamamoto T Kuroiwa Y Yokoi T Deficient cotinine formation from nicotine is attributed to the whole deletion of the CYP2A6 gene in humans Clin Pharmacol Ther 2000 67 57–69 Nakajima M Yamamoto T Nunoya K Yokoi T Nagashima K Inoue K Role of human cytochrome P4502A6 in C-oxidation of nicotine Drug Metab Dispos 1996 24 1212–7 Nakajima M Yoshida R Fukami T McLeod HL Yokoi T Novel human CYP2A6 alleles confound gene deletion analysis FEBS Lett 2004 569 75–81 Nowak MP Sellers EM Tyndale RF Canadian native Indians exhibit unique CYP2A6 and CYP2C19 mutant allele frequencies Clin Pharmacol Ther 1998 64 378–83 Nunoya K Yokoi T Takahashi Y Kimura K Kinoshita M Kamataki T Homologous unequal cross-over within the human CYP2A gene cluster as a mechanism for the deletion of the entire CYP2A6 gene associated with the poor metabolizer phenotype J Biochem 1999 126 402–7 Nurfadhlina M Foong K Teh LK Tan SC Mohd Zaki S Ismail R CYP2A6 polymorphisms in Malays, Chinese and Indians Xenobiotica 2006 36 684–92 O’Loughlin J Paradis G Kim W DiFranza J Meshefedjian G McMillan-Davey E Genetically decreased CYP2A6 and the risk of tobacco dependence: a prospective study of novice smokers Tob Control 2004 13 422–8 Oscarson M Gullstén H Rautio A Bernal ML Sinues B Dahl ML Genotyping of human cytochrome P450 2A6 (CYP2A6), a nicotine C-oxidase FEBS Lett 1998 438 201–5 Oscarson M McLellan RA Asp V Ledesma M Bernal Ruiz ML Sinues B Characterization of a novel CYP2A7/CYP2A6 hybrid allele (CYP2A6*12) that causes reduced CYP2A6 activity Hum Mutat 2002 20 275–83 Oscarson M McLellan RA Gullstén H Agúndez JAG Benítez J Rautio A Identification and characterisation of novel polymorphisms in the CYP2A locus:Implications for nicotine metabolism FEBS Lett 1999 460 321–7 Oscarson M McLellan RA Gullstén H Yue QY Lang MA Luisa Bernal M Characterisation and PCR-based detection of a CYP2A6 gene deletion found at a high frequency in a Chinese population FEBS Lett 1999 448 105–10 Pan L Yang X Li S Jia C Association of CYP2A6 gene polymorphisms with cigarette consumption:A meta-analysis Drug Alcohol Depend 2015 149 268–71 Pang C Liu J-H Xu Y-S Chen C Dai P-G The allele frequency of CYP2A6*4 in four ethnic groups of China Exp Mol Pathol 2015 98 546–8 Paschke T Riefler M Schuler-Metz A Wolz L Scherer G McBride CM Comparison of cytochrome P450 2A6 polymorphism frequencies in Caucasians and African-Americans using a new one-step PCR-RFLP genotyping method Toxicology 2001 168 259–68 Peamkrasatam S Sriwatanakul K Kiyotani K Fujieda M Yamazaki H Kamataki T In vivo evaluation of coumarin and nicotine as probe drugs to predict the metabolic capacity of CYP2A6 due to genetic polymorphism in Thais Drug Metab Pharmacokinet 2006 21 475–84 Pérez-Rubio G Sansores R Ramírez-Venegas A Camarena Á Pérez-Rodríguez ME Falfán-Valencia R Nicotine addiction development: from epidemiology to genetic factors Rev Investig Clín 2015 67 333 334 Piliguian M Zhu AZX Zhou Q Benowitz NL Ahluwalia JS Cox LS Novel CYP2A6 variants identified in African Americans are associated with slow nicotine metabolism in vitro and in vivo Pharmacogenet Genom 2014 24 118–28 Pitarque M von Richter O Oke B Berkkan H Oscarson M Ingelman-Sundberg M Identification of a single nucleotide polymorphism in the TATA box of the CYP2A6 gene:impairment of its promoter activity Biochem Biophys Res Commun 2001 284 455–60 Pitarque M von Richter O Rodríguez-Antona C Wang J Oscarson M Ingelman-Sundberg M A nicotine C-oxidase gene (CYP2A6) polymorphism important for promoter activity Hum Mutat 2004 23 258–66 Rao Y Hoffmann E Zia M Bodin L Zeman M Sellers EM Duplications and defects in the CYP2A6 gene: identification, genotyping, and in vivo effects on smoking Mol Pharmacol 2000 58 747–55 Ray R Tyndale RF Lerman C Nicotine dependence pharmacogenetics:role of genetic variation in nicotine-metabolizing enzymes J Neurogenet 2009 23 252 261 Roco Á Quiñones L Agúndez JAG García-Martín E Squicciarini V Miranda C Frequencies of 23 functionally significant variant alleles related with metabolism of antineoplastic drugs in the Chilean population: comparison with Caucasian and Asian populations Front Genet 2012 3 1–9 Rossini A Soares Lima S Rapozo DCM Faria M Albano RM Ribeiro Pinto LF CYP2A6 and CYP2E1 polymorphisms in a Brazilian population living in Rio de Janeiro Braz J Med Biol Res 2006 39 195–201 Sabol SZ Hamer DH An improved assay shows no association between the CYP2A6 gene and cigarette smoking behaviour Behav Genet 1999 157 632–4 Schoedel KA Hoffmann EB Rao Y Sellers EM Tyndale RF Ethnic variation in CYP2A6 and association of genetically slow nicotine metabolism and smoking in adult Caucasians Pharmacogenetics 2004 14 615–26 Schulz TG Ruhnau P Hallier E Lack of correlation between CYP2A6 genotype and smoking habits Adv Exp Med Biol 2001 500 213–5 Sepehr A Kamangar F Abnet CC Fahimi S Pourshams A Poustchi H Genetic polymorphisms in three Iranian populations with different risks of esophageal cancer, an ecologic comparison Cancer Lett 2004 213 195–202 Shimada T Yamazaki H Guengerich FP Ethnic-related differences in coumarin 7-hydroxylation activities catalyzed by cytochrome P4502A6 in liver microsomes of Japanese and Caucasian populations Xenobiotica 1996 26 395–403 Sim SC Ingelman-Sundberg M The human cyto-chrome P450 (CYP) allele nomenclature website: a peer-reviewed database of CYP variants and their as-sociated effects Hum Genom 2010 4 278–81 Sim SC Ingelman-Sundberg M Update on allele no-menclature for human cytochromes P450 and the human cytochrome P450 allele (CYP-allele) nomen-clature database Methods Mol Biol 2013 987 251 259 Song D-K Xing D-L Zhang L-R Li Z-X Liu J Qiao B-P Association of NAT2, GSTM1, GSTT1, CYP2A6, and CYP2A13 gene polymorphisms with susceptibility and clinicopathologic characteristics of bladder cancer in Central China Cancer Detect Prev 2009 32 416–23 Soriano A Vicente J Carcas C Gonzalez-Andrade F Arenaz I Martinez-Jarreta B Differences between Spaniards and Ecuadorians in CYP2A6 allele frequencies: comparison with other populations Fund Clin Pharmacol 2011 25 627–32 Strasser AA Benowitz NL Pinto AG Tang KZ Hecht SS Carmella SG Nicotine metabolite ratio predicts smoking topography and carcinogen biomarker level Cancer Epidemiol Biomarkers Prev 2011 20 234–8 Svyryd Y Ramírez-Venegas A Sánchez-Hernández B Aguayo-Gómez A Luna-Muñoz L Arteaga-Vázquez J Genetic risk determinants for cigarette smoking dependence in Mexican estizo families Nicotine Tob Res 2015 18 620–5 Swan GE Benowitz NL Lessov CN Jacob P Tyndale RF Wilhelmsen K Nicotine metabolism:the impact of CYP2A6 on estimates of additive genetic influence Pharmacogenet Genom 2005 15 115–25 Swan GE Jack LM Ward MM Subgroups of smokers with different success rates after use of transdermal nicotine Addiction 1997 92 207–17 Takeshita H Hieda Y Fujihara J Xue Y Nakagami N Takayama K CYP2A6 polymorphism reveals differences in Japan and the existence of a specific variant in Ovambo and Turk populations Hum Biol 2006 78 235–42 Tamaki Y Arai T Sugimura H Sasaki T Honda M Muroi Y Association between cancer risk and drug-metabolizing enzyme gene (CYP2A6, CYP2A13, CYP4B1, SULT1A1, GSTM1, and GSTT1) polymorphisms in cases of lung cancer in Japan Drug Metab Pharmacokinet 2011 26 516–22 Tan W Chen GF Xing DY Song CY Kadlubar FF Lin DX Frequency of CYP2A6 gene deletion and its relation to risk of lung and esophageal cancer in the Chinese population Int J Cancer 2001 95 96–101 Thorgeirsson TE Gudbjartsson DF Surakka I Vink JM Amin N Geller F Sequence variants at CHRNB3-CHRNA6 and CYP2A6 affect smoking behavior Nat Genet 2010 42 448–53 Tiihonen J Pesonen U Kauhanen J Koulu M Hallikainen T Leskinen L CYP2A6 genotype and smoking Mol Psychiatry 2000 5 347–8 Tiong KH Mohammed Yunus NA Yiap BC Tan EL Ismail R Ong CE Inhibitory potency of 8-methoxypsoralen on cytochrome P450 2A6 (CYP2A6) allelic variants CYP2A6 15, CYP2A6 16, CYP2A6 21 and CYP2A6 22: differential susceptibility due to different sequence locations of the mutations PloS One 2014 9 e86230 Tiong KH Yiap BC Tan EL Ismail R Ong CE Func-tional characterization of cytochrome P450 2A6 allel-ic variants CYP2A6*15, CYP2A6 *16, CYP2A6*21, and CYP2A6*22 Drug Metab Dispos 2010 38 745–51 Tiwawech D Srivatanakul P Karalak A Ishida T Cytochrome P450 2A6 polymorphism in nasopha-ryngeal carcinoma Cancer Lett 2006 241 135–41 Topcu Z Chiba I Fujieda M Shibata T Ariyoshi N Yamazaki H CYP2A6 gene deletion reduces oral cancer risk in betel quid chewers in Sri Lanka Carcinogenesis 2002 23 595–8 Uno T Obe Y Ogura C Goto T Yamamoto K Nakamura M Metabolism of 7-ethoxycoumarin, safrole, flavanone and hydroxyflavanone by cytochrome P450 2A6 variants Biopharm Drug Dispos 2013 34 87–97 Vasconcelos GM Struchiner CJ Suarez-Kurtz G CYP2A6 genetic polymorphisms and correlation with smoking status in Brazilians Pharmacogenom J 2005 5 42–8 Veiga MI Asimus S Ferreira PE Martins JP Cavaco I Ribeiro V Pharmacogenomics of CYP2A6, CYP2B6, CYP2C19, CYP2D6, CYP3A4, CYP3A5 and MDR1 in Vietnam Eur J Clin Pharmacol 2009 65 355–63 Verde Rello Z Santiago Dorrego C Gene genetics of the tobacco smoking Med Clín (Barcelona) 2013 140 66–7 von Richter O Pitarque M Rodríguez-Antona C Testa A Mantovani R Oscarson M Polymorphic NF-Y dependent regulation of human nicotine C-oxidase (CYP2A6) Pharmacogenetics 2004 14 369–79 Wang J Pitarque M Ingelman-Sundberg M 3’-UTR polymorphism in the human CYP2A6 gene affects mRNA stability and enzyme expression Biochem Biophys Res Commun 2006 340 491–7 Wassenaar CA Dong Q Wei Q Amos CI Spitz MR Tyndale RF Relationship between CYP2A6 and CHRNA5-CHRNA3-CHRNB4 variation and smoking behaviors and lung cancer risk J Natl Cancer Inst 2011 103 1342–6 Wassenaar CA Ye Y Cai Q Aldrich MC Knight J Spitz MR CYP2A6 reduced activity gene variants confer reduction in lung cancer risk in African American smokers-findings from two independent populations Carcinogenesis 2015 36 99–103 WHO, World Health Organization WHO report on the global tobacco epidemic, 2011 2011 World Health Organization Available from: http://www.who.int/tobacco/global_report/2011/en/. Xu C Rao YS Xu B Hoffmann E Jones J Sellers EM An in vivo pilot study characterizing the new CYP2A6*7, *8, and *10 alleles Biochem Biophys Res Commun 2002 290 318–24 Yamano S Tatsuno J Gonzalez FJ The CYP2A3 gene product catalyzes coumarin 7-hydroxylation in human liver microsomes Biochemistry 1990 29 1322–9 Yoshida R Nakajima M Nishimura K Tokudome S Kwon JT Yokoi T Effects of polymorphism in promoter region of human CYP2A6 gene (CYP2A6*9) on expression level of messenger ribonucleic acid and enzymatic activity in vivo and in vitro Clin Pharmacol Ther 2003 74 69–76 Yoshida R Nakajima M Watanabe Y Kwon JT Yokoi T Genetic polymorphisms in human CYP2A6 gene causing impaired nicotine metabolism Br J Clin Pharmacol 2002 54 511–7 Yuan J-M Nelson HH Butler LM Carmella SG Wang R Kuriger-Laber JK Genetic determinants of cytochrome P450 2A6 activity and biomarkers of tobacco smoke exposure in relation to risk of lung cancer development in the Shanghai cohort study Int J Cancer 2016 138 2161–71 Yusof W Gan SH High prevalence of CYP2A6*4 and CYP2A6*9 alleles detected among a Malaysian population Clin Chim Acta 2009 403 105–9 Zhang X Amemo K Ameno S Iwahashi K Kinoshita H Kubota T Lack of association between smoking and CYP2A6 gene polymorphisms in A Japanese population Nihon Arukoru Yakubutsu Igakkai Zasshi 2001 36 486–90 <italic>CYP2A6</italic> location and mutations in the gene. Mutations are reported by the <italic>Human CYP-Allele Nomenclature Database </italic>(http://www.cypalleles.ki.se) and include insertion, deletion, CNV and SNP. Ref Seq NG_008377.1 <italic>CYP2A6</italic> alleles reported in tobacco consumption related studies. Number of <italic>CYP2A6</italic> alleles that have reported frequencies in population and association studies related to tobacco/nicotine consumption and cancer related to tobacco consumption (in the population study).

The populations are grouped according to possible ancestral and / or geographical origin: African (Canadian, American, Ghanaian, Ethiopian, Namibian, “African” and “Black” populations). Caucasian (German, Canadian, American, Spanish, Finish, French, Hungarian, English, Serbian, Swedish, “Caucasian” and “Whites”). East Asian (Chinese, Korean, Japanese, Malaysia, Thai, Taiwanese, Vietnamese, Han Chinese, Uighur, Bouyei, Tibetan, Shimane, Tottori, Fukuoka, Ehime and “Asian”) South Asian (Indian, Bangladeshi, Sri Lanka, Tamilian, Kannadika, Keralites and Andhrites). Middle East (Iranian, Turkish, Tatar, Turks, Turkomans and Zoroastrian Persians). American Continent (Hispanic, Brazilian, Chilean, Ecuadorian, Mexican, Canadian Native and Alaskan Yupik). Oceania (Neo Zealander Māori). *Except African American, American and Canadian.