Water samples from Fetzara Lake (36°43' and 36°50'N, 7°24' and 7°39'E) were collected during winter (January 2017). The samples were heat treated at 50 °C for 30 min and 10-fold serial dilutions were prepared. Aliquots of 0.1 ml were spread plated onto Casein Starch agar (CSA) (g/l) (soluble starch, 10; casein, 0.3; KNO₃, 2.0; MgSO₄.7H₂O, 0.05; K₂HPO₄, 2.0; NaCl, 2; CaCO₃, 0.02; FeSO₄.7H₂O, 0.01 agar 20) supplemented with (2.5 μg/ml of rifampicin, 10 μg/ml of amphotericin B and 75 μg/ml of fuconazol). Plates were incubated at 30 °C for 7 days up to 4 weeks, and actinobacteria-like strain designated ActiF450 was isolated, subcultured and maintained on CSA slants at 4 °C. Spore suspensions were prepared in glycerol 20 % and stored at -80 °C for further use.

Morphological characteristics such as aerial mass color and substrate mycelium were observed on soya flour mannitol (SFM) plates. The aerial mass and color of the substrate mycelium were recorded and classified according to Bergey's Manual of Systematic Bacteriology and ISCC-NBS Color Charts standard (Kelly and Judd, 1964[19]; Vos et al. 2009[40]). The tolerance of NaCl, pH, and the effect of temperature was determined by cultivating on ISP2 medium. Nitrate reduction, hemolytic activity and production of amylase, gelatinase, protease and lipase were determined by cultivation on various media as described by Benhadj et al. (2019[10]) using starch, gelatin, casein and Tween 80 as substrates, respectively.

The genomic DNA of the strain ActiF450 was extracted as described by Kieser et al. (2000[20]). A loopful of mycelium was scraped from colonies grown on CSA and suspended in 5 ml of saline-EDTA (5M NaCl, 0.5 M EDTA [pH 8.0], Tris-HCL [pH 7.5]) by vortexing. Lysozyme was added to a final concentration of 1 mg/ml, followed by incubation at 37 °C for 60 min. Later, 10 μl of 1 % (wt/vol) proteinase K and 200 μl of 10 % sodium dodecyl sulfate were added, and the mixed solution was incubated at 50 °C for 2 hours. Subsequently, 500 μl of 5M NaCL was added and the lysate was centrifuged (15,000 g, 5 min) before sequential extractions with phenol, followed by chloroform. The aqueous phase was precipitated using 0.6 ml isopropanol and two volumes of 70 % ethanol. The DNA was suspended in 100 μl of TE 1X (10 mM Tris-HCl at pH 8, 1 mM EDTA) and stored at -20 °C for further use.

The 16S rRNA gene was amplified by PCR using the universal primers Fd1 (5' AGAGTTTGATCCTGGCTCAG) and rP2 (5'-AAGGAGGTGATCCAGCC) (Weisburg et al., 1991[41]). Sequence similarity calculations were carried out using an alignment search program with the EzTaxon-server (Chun et al., 2007[16]). Evolutionary trees based on the aligned sequences were inferred using the neighbor-joining method (Saitou and Nei, 1987[34]) and topologies were evaluated by bootstrap sampling expressed as percentage of 1000 replicates. Phylogenetic analyses were conducted using MEGA software version 6 (Tamura et al., 2013[38]).

For antifungal activity investigation, the following pathogenic yeasts and filamentous fungi were used: Candida krusei ATCC6258, Candida parapsilosis ATCC22019, clinical Candida isolates (ICF18, ICF19, ICF20, ICF21, ICF22, ICF23, ICF24, ICF35, ICF37 and ICF38), Saccharomyces sp. ICF43, Kluveromyces sp. ICF44, Rhodotorula mucilaginosa YA1, Aspergillus fumigatus MA1, A. calidoustus A5, A. niger (IAF27 and MA2), Aspergillus sp. ICF58V, Arthroderma vanbreuseghemii ICF62B, Scopulariopsis brevicaulis ICF57, Fusarium oxysporum, F. solani, Scedosporium apiospermum, Lichtheimia corymbifera ST87, Lomentospora prolificans ST67, Microsporum canis ICF58B, Pecilomyces variotii, Penicillium chrysogenum ICF 59, Rhizopus oryzae and Scodapulariopsis candida ICF53. For antibacterial activity, seven clinical Staphylococcus aureus isolates were used including two references strains Staphylococcus aureus ATCC25293 and Staphylococcus aureus ATCC43300. All fungal and bacterial cultures were maintained on Potato Dextrose Agar (PDA) and Luria Bertani slants respectively at 4 °C.

Antimicrobial activity was first screened using the conventional agar cylinders method on Potato Dextrose Agar (PDA) and Luria Bertani (LB) plates for fungi and bacteria respectively (Benhadj et al., 2019[10]). Mycelium plugs (7 mm diameter) of ActiF450 incubated at different time (3, 7, 10 and 14 days) were inoculated onto PDA and LB plates previously inoculated with target pathogens. Secondly, a double layer method was used for confirmation. The active strain ActiF450 was inoculated as a spot in the center of ISP2 plates at 30 °C for 7 days. After incubation, the plates were then covered by 10 ml of PDA and LB previously inoculated with target fungi and bacteria respectively (Badji et al., 2005[6]). The inhibition zones around each spot were measured (mm) after 24 h at 37 °C for bacteria, 48 h and 7 days at 30 °C for yeast and moulds respectively. Two replicates were prepared for each test and plates with indicator strain were used as control.

To extract antimicrobial compounds, strain ActiF450 was inoculated onto ISP2 plates at 30 °C for 10 days. After growth, the cultures were fragmented and extracted with an equal volume of different solvents (n-butanol, dichloromethane, ethanol, ethyl acetate, methanol and hexane). The mixtures were filtered through a Whatman No. 1 filter after a vigorous agitation for one hour, and the collected organic extracts were concentrated using a rotary vacuum evaporator. The crude extracts were separately dissolved in 10 % dimethyl sulfoxide (DMSO) and absolute methanol with a final concentration of 20.0 mg/ml. After filtering through a 0.22 μm Millipore filter, different crude extract solutions were used to analyze the inhibition ability using the disc diffusion method (Mehalaine et al., 2017[26]).

In the present study, an active actinobacterium ActiF450 strain was isolated from a natural and unexplored wetland ecosystem (Fetzara Lake) located in Northeastern Algeria. The vegetative and aerial mycelia as well as soluble pigments of the strain ActiF450 were evaluated after cultures on different media for 10 days at 30 °C. Colors of mycelia were determined using the ISCC-NBS centroid color chart (Kelly and Judd, 1964). ActiF450 can grow well on ISP1, ISP2, Bennett and Glucose Yeast Extract Agar (GYEA). The strain produced white grayish aerial and substrate mycelia on ISP2 agar. However, no diffusible pigments were produced, after 10 days of incubation. The microscopic analysis revealed that the strain ActiF450 produced well developed and branched aerial mycelium with spore chains in the top ends (Figure 1(Fig. 1)). The strain was moderately halo tolerant up to 5 % of NaCl concentration. Growth occurs at 25 to 40  °C (optimum, 37  °C) and pH 6.0-9.0 (optimum, pH 7.0). ActiF450 could degrade casein, starch, Tween 80 and liquefy gelatin indicating the variety for their complex metabolites and genomic organization (Bentley et al., 2002[11]). However, the strain was unable to produce urease and H₂S.

The 16S rRNA partial sequence (1,417 bp) of the strain ActiF450 was amplified and sequenced. The data indicated that strain ActiF450 belongs to the genus Streptomyces and was referred to as Streptomyces sp. ActiF450. The sequence was subjected to alignment and the BLAST search showed high level of similarity values (99.65 %, 99.22 % and 99.15 %) with Streptomyces malaysiensis NBRC16446 ^T (Al-Tai et al., 1999[3]), S. samsunensis M1463^T (Sazak et al., 2011[35]) and S. solisilvae HNM0141^T (Zhou et al., 2017[43]), respectively. The result was supported by the phylogenetic tree constructed using the neighbor-joining method, where Streptomyces sp. ActiF450 formed a subclade and clustered with both S. malaysiensis and S. samsunensis (Figure 1(Fig. 1)).

The results presented in Table 1(Tab. 1) showed that the strain Streptomyces sp. ActiF450 exhibited a broad-spectrum antimicrobial activity against both indicator organisms (bacteria and fungi), from which highly activity were recorded. High inhibitory activities were found against the yeast Rhodotorula mucilaginosa YA1 (inhibition zone diameter of 67.6±2.7 mm), and filamentous fungi Aspergillus niger MA2 (54.0 ± 6.0 mm), followed by Microsporum canis ICF58B (55.0 mm), Arthroderma vanbreuseghemii ICF62B (49.2±2.8 mm), Fusarium oxysporum F15 (41.2±7.4 mm), Penicillium chrysogenum ICF59 (41.1±5.9 mm) and Scodapulariopsis candida ICF53 (35.0±2.5 mm). Data clearly indicate that strain ActiF450 exhibited a significant antimicrobial activity against Candida spp. (15 to 27 mm), Candida-like species Kluveromyces sp. ICF44 (25.6±6.2 mm), Saccharomyces sp. ICF43 (17.0±0.0 mm)as well as Gram-positive bacteria (Staphylococcus aureus clinical isolates) (26.5-35.5 mm).

As shown in Figure 2a(Fig. 2), the antimicrobial activity of the strain ActiF450 against selected S. aureus isolates started after two days of incubation and reached a maximum after seven days of culture in ISP2. These activities were persistent until the end of the incubation. Furthermore, the anticandidal activity was observed at the first four days of incubation. However, the highest activity was recorded at the third day of incubation period. Thereafter, the activity dramatically declined after one week (Figure 2b(Fig. 2)).

Several reports highlighted the production of various antimicrobial compounds by Streptomyces strains with different and variable activities depending on culture conditions including; media nature and/or composition (nitrogen and carbon sources), time of incubation even the indicator organisms used in the confrontation test (Vijayakumar et al., 2012[39]).

The differences in susceptibility among tested organisms are in concordance with previous studies by the fact that fungal organisms are eukaryotic, and their structures are different from bacteria (Benhadj et al., 2019[10]). The absence of acidic phospholipids and presence of sterols may reduce susceptibility of eukaryotic cells to lytic molecules (Alan and Earle, 2002[1]). The maximum antibacterial activity after seven to ten days of incubation may be attributed to the fact that ActiF450 reached the stationary phase of growth. It has been reported that the bioactive metabolites production by Streptomyces takes place in the stationary phase of the growth (Augustine et al., 2004[5]) and the decrease in the anticandidal activity after three days can be attributed to the decrease in the supply of nutrients or the accumulation of toxic substances.

Members of the genus Streptomyces have attracted extensive attention due to the tremendous success of their natural products in practical application. With their complex life cycle, Streptomyces are renowned for the production of an outstandingly large number of bioactive metabolites and accounts for 80 % of the currently available antibiotic-like substances including antifungals and antibacterials (Niu et al., 2016[31]). However, few studies related to the antimicrobial activities of Streptomyces malaysiensis, or the closest strains (S. samsunensis and S. solisilvae) were attempted so far. Our results indicate that ActiF450 could be a potential strain for the development of antimicrobial drugs against a wide range of human pathogenic bacteria and fungi including Candida-like species and dermatophytes (Figure 3(Fig. 3)).

As an effort to study the antimicrobial potential of the strain, assays were conducted on the different extracts of ActiF450 against Candida albicans sp. ICF23 and S. aureus IC30 (Table 2(Tab. 2)). Traditionally, the discovery of bioactive molecules from microbial sources such as actinomycetes has generally involved, cultivation under different growth conditions, screening of biological activities, extraction of the metabolites, and analysis of the extract for bioactivity. The results reflected that the ethyl acetate, hexane and methanol extracts dissolved in DMSO at 10 % exhibited potent activity against both C. albicans ICF23 and S. aureus IC30. Other extracts showed moderate activity. In addition, significant differences in susceptibility were noted; where S. aureus was high susceptible to ActiF450 extracts compared to C. albicans.

This fact might indicate the existence of a synergistic effect among different metabolites produced by ActiF450 which is lost when they are separated during the extraction (Genilloud, 2017[18]). Otherwise, the antifungal activity might be related to the presence of proteins or enzymes labile to hydrophilic solvents such as chitinases and glucanases capable of degrading the cell wall of the fungi (Benhadj et al., 2019[10]). Studies reviewed by Genilloud (2017[18]) show that actinomycetes continue to be a valuable source of antibiotic activity as they produce a broad spectrum of different antifungal and antibacterial compounds. Moreover, study results indicate a marked effect of the extraction solvents on the isolation of bioactive compounds. It has also been reported that organic solvents provides a higher efficiency in extracting compounds for antimicrobial activities (Lima-Filho et al., 2002[23]).

Previous study on Streptomyces malaysiensis MJM1968 reported a strong inhibitory activity in vitro by dual-culture in vitro assay on several phytopathogenic fungi such as Alternaria mali, Cladosporium cladosporioides, Colletotrichum gloeosporioides, Fusarium chlamydosporum, Fusarium oxysporum, Rhizoctonia solani (Cheng et al., 2010[15]). In addition, the compound, which exhibited antifungal activity, was identified as Azalomycin F complex.

Recently, Zhang et al. (2019[42]) have reported the effect of different fermentation factors for Azalomycin F production from S. malaysiensis strain ECO00002. Similarly, Li et al. (2008[22]) have also reported another promising antifungal activity of perhydrofuropyran C-nucleoside named Malayamycin isolated from Streptomyces malaysiensis ATB-11 (Al-Tai et al., 1999[3]).